Am. J. Bot. Li-Cor Advertisement
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(American Journal of Botany. 2008;95:1177-1188.)
doi: 10.3732/ajb.0800132
© 2008 Botanical Society of America, Inc.
  Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter
What's this?
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dunbar-Co, S.
Right arrow Articles by Morden, C. W.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Dunbar-Co, S.
Right arrow Articles by Morden, C. W.
Agricola
Right arrow Articles by Dunbar-Co, S.
Right arrow Articles by Morden, C. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Systematics and Phytogeography

Molecular phylogeny and adaptive radiation of the endemic Hawaiian Plantago species (Plantaginaceae)1

Stephanie Dunbar-Co2,4, Ania M. Wieczorek3 and Clifford W. Morden2

2 Department of Botany, University of Hawai‘i, 3190 Maile Way, Honolulu, Hawai‘i 96822 USA 3 Department of Tropical Plant and Soil Sciences, University of Hawai‘i, 3190 Maile Way, Honolulu, Hawai‘i 96822 USA

Received for publication 9 April 2008. Accepted for publication 19 July 2008.

ABSTRACT

Insular oceanic islands provide excellent opportunities for the study of evolutionary processes and adaptive radiation. The Hawaiian Plantago radiation comprises six endemic taxa showing considerable inter- and intraspecific morphological and ecological diversity. The rDNA internal (ITS) and external (ETS) transcribed spacers and two recently described chloroplast spacers, ndhF-rpl32 and rpl32-trnL, were sequenced to study phylogenetic relationships within this morphologically complex group. Phylogenetic analysis provided strong evidence for the monophyly of Hawaiian Plantago, suggesting that the lineage arose from a single long-distance dispersal event. Inconsistencies between nuclear and chloroplast phylogenies suggest a history of hybridization. The basal, unresolved dichotomy of the combined phylogeny is consistent with rapid phenotypic diversification of the major lineages early in the history of this group. Speciation has largely occurred allopatrically, with divergence a result of intraisland ecological shifts between bog and woodland habitats and interisland dispersal events. Most interisland colonizations were from older to younger islands with initial colonization of Kaua‘i. In our analysis, P. pachyphylla is paraphyletic and taxonomic separation of the distinct morphotypes of this species appears justified. Furthermore, the apparent hybrid ancestry and unique morphology and habitat of the endangered P. princeps var. longibracteata support its recognition at the specific rank.

Key Words: adaptive radiation • biogeography • Hawaiian Islands • hybridization • ndhF-rpl32 • phylogeny • Plantaginaceae • Plantagorpl32-trnL

Insular oceanic islands offer isolation from source populations and a close association of a diversity of habitats. The evolutionary consequences are rapid speciation events often coupled with remarkable examples of adaptive radiation (Darwin, 1859Go). The Hawaiian Archipelago encompasses an ideal system in which to study these phenomena. Islands in the archipelago were formed chronologically with the younger, current high islands (Kaua‘i, O‘ahu, Moloka‘i, Maui, Lana‘i, Kaho‘olawe, and Hawai‘i) occupying the southeast portion of the chain (Carson and Clague, 1995Go; Funk and Wagner, 1995Go). The archipelago is also the most isolated large group of islands in the world (ca. 3800 km from the nearest continental migrant source), which has resulted in infrequent colonization and thus an increased chance that the patterns observed in endemic lineages can be attributed to single colonization events (Fosberg, 1948Go; Carlquist, 1980Go). Hawaiian lineages are often further characterized by rapid diversification enhanced by reduced competition and a diversity of habitats generally in close proximity to one another (Carlquist, 1974Go; Price and Wagner, 2004Go). These characteristics allow evolutionary patterns to be more easily discerned, making Hawaiian lineages important subjects of evolutionary study. Despite this, there have been relatively few studies of phylogenetic and potentially adaptive radiations in Hawaiian plant groups (Helenurm and Ganders, 1985Go; Baldwin et al., 1991Go; Givnish et al., 1995Go; Ballard and Sytsma, 2000Go; Carlquist et al., 2003Go; Lindqvist et al., 2003Go; Nepokroeff et al., 2003Go; Geiger and Ranker, 2005Go; Howarth and Baum, 2005Go; Sakai et al., 2006Go). This situation is no doubt in part due to the recent derivation of these groups, which has made it difficult to reconstruct their evolutionary histories with commonly used molecular phylogenetic markers, and as a result, has left many Hawaiian plant lineages in need of phylogenetic study.

To further our understanding of adaptive radiation and island evolution in a Hawaiian plant group, we have focused on the endemic Hawaiian Plantago L. species. Plantago is a large genus (ca. 200–260 species) with a worldwide distribution. Morphological classification groups the Hawaiian species into section Plantago (ca. 42 species), which includes many oceanic island species in addition to North American and Old World taxa (Rahn, 1996Go). Similar to other Hawaiian plant groups, the Hawaiian Plantago species occur in a variety of habitats such as bogs, wet ridges tops, subalpine shrubland, mesic forest, rainforest, and waterfalls and have diverged in growth form (including woodiness), leaf morphology, and reproductive features. As such, conclusions drawn from this study may have relevance to similar groups. Nevertheless, Hawaiian Plantago is understudied and relatively poorly known. The most recent treatment of the Hawaiian flora recognizes only three endemic species and four varieties of Plantago [P. pachyphylla A. Gray, P. hawaiensis (A. Gray) Pilg., and P. princeps Cham. & Schltdl. var. anomala Rock, P. princeps Cham. & Schltdl. var. laxifolia A. Gray, P. princeps Cham. & Schltdl. var. longibracteata H. Mann, and P. princeps Cham. & Schltdl. var. princeps] (Wagner et al., 1990Go). However, these species’ considerable inter- and intraspecific morphological and ecological diversity has led to broad disagreement regarding the number of taxa that should be recognized and their relationships to one another (Gray, 1862Go; Hillebrand, 1888Go; Rock, 1920Go; Pilger, 1923Go, 1936Go, 1937Go; Skottsberg, 1944Go; Wagner et al., 1990Go). Further complicating species delimitations in the group is the apparent, frequent hybridization in areas of sympatry where morphological differences between taxa and morphotypes can often be obscured. The substantial morphological diversity encompassed by populations of P. pachyphylla and P. princeps, in particular, have led researchers to suggest that these species are in fact species complexes (Wagner et al., 1990Go). Morphotypes within these species can be differentiated by habitat; growth form; leaf arrangement, attachment, and pubescence; and the position of the flower relative to the spike (Table 1). Greenhouse experiments carried out in conjunction with this study indicate that these differences are genetically based and not simply from phenotypic plasticity (Dunbar-Co et al., in pressGo). Within Hawaiian Plantago, growth form appears to be correlated with habitat; woody morphotypes are found largely in woodland habitats (includes forest and shrubland habitats), whereas herbs are primarily restricted to open bogs or boglike habitats such as wet ridge tops. Morphological and ecological characteristics provide support for loosely subdividing Hawaiian Plantago into 13 distinct morphotypes (Table 1).


View this table:
[in this window]
[in a new window]

 
Table 1. Morphological and ecological variation in Hawaiian Plantago. H, Hawai‘i; K, Kaua‘i; eM, East Maui; wM, West Maui; Mo, Moloka‘i; eO, eastern O‘ahu; wO, western O‘ahu.

 
Here, we conducted a molecular phylogenetic analysis to delimit species, elucidate relationships among them, and examine evolutionary patterns in this poorly known group using DNA sequences of the ribosomal DNA internal (ITS) and external (ETS) transcribed spacers in combination with two rapidly evolving spacer regions from the chloroplast genome, ndhF-rpl32 and rpl32-trnL. The primary objectives of this study were to (1) present the first phylogeny of the Hawaiian Plantago radiation, (2) assess the monophyly of the group, (3) elucidate relationships among Hawaiian Plantago taxa and morphotypes, including an assessment of possible hybridization between species, (4) determine modes of speciation, and (5) investigate the historical biogeography of the group.

MATERIALS AND METHODS

Taxon sampling and DNA extraction
The abundant intraspecific variation and the lack of a full systematic treatment prompted us to collect leaf material from all known extant, morphologically and geographically distinct populations. Within islands, samples were collected from different volcanoes to give age structure within islands (e.g., West Maui vs. East Maui, Wai‘anae vs. Ko‘olau). A total of 21 Hawaiian Plantago individuals, including multiple accessions of all currently recognized taxa, were collected from every island and included for analysis (Appendix 1). To assess intrapopulational variation, two or three individuals were sampled from every population. Plantago macrocarpa Cham. & Schltdl., P. rapensis Pilg., P. rupicola Pilg., and P. spathulata Hook.f were used as outgroup taxa for this study based on DNA sequence analysis of section Plantago that included the three Hawaiian species (R. K. Hoggard [University of Oklahoma], N. Rønsted [Kew], S. Dunbar-Co [Univ. of Hawai‘i], and P. J. Kores and W. J. Elisens [Univ. of Oklahoma], unpublished data).

Total genomic DNA was extracted from fresh leaf tissue using a slightly modified version of the CTAB extraction protocol (Doyle and Doyle, 1987Go) or from silica-gel-dried tissue using the DNeasy Plant Mini kit (Qiagen, Valencia, California, USA) according to the manufacturer’s instructions. Samples were accessioned into the Hawaiian Plant DNA Library (Morden et al., 1996Go; Randell and Morden, 1999Go).

Molecular markers
Nuclear and chloroplast DNA gene regions were obtained for phylogenetic analysis. The internal transcribed spacer (ITS) and external transcribed spacer (ETS) regions of the nuclear ribosomal DNA have both been shown to provide species-level phylogenetic signal (Baldwin et al., 1995Go; Baldwin and Markos, 1998Go; Linder et al., 2000Go; Andreasen and Baldwin, 2001Go; Markos and Baldwin, 2001Go; Nepokroeff et al., 2003Go; Timme et al., 2007Go). Two intergenic spacers from the small single-copy region of the chloroplast genome (ndhF-rpl32 and rpl32-trnL) were also sequenced having recently yielded appropriate amounts of variation for species and even population-level phylogenetic studies (Shaw et al., 2007Go). Including gene regions from the nuclear (biparentally inherited) and chloroplast (uniparentally inherited) genomes allowed us to assess discordance among the respective phylogenies, giving insight regarding the influence of hybridization on the Hawaiian Plantago species (Rieseberg and Soltis, 1991Go; Baldwin, 1997Go; Sang and Zhong, 2000Go).

Amplification and DNA sequencing
The four gene regions were amplified and sequenced using standard primers found in the literature (White et al., 1990Go; Downie and Katz-Downie, 1996Go; Baldwin and Markos, 1998Go; Shaw et al., 2007Go). ITS amplifications used the following polymerase chain reaction (PCR) conditions: 95°C for 2 min, 35 cycles of 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, final extension of 72°C for 7 min. ETS amplification conditions differed by having a 61°C annealing temperature and used a newly developed 5' primer (PlanF: GTACCTGGGAAGGACACCAA) located approximately 750 bp upstream of the 18S gene. Chloroplast gene amplifications used the following cycling conditions: 95°C for 2 min, 30 cycles of 95°C for 30 s, 50°C for 1 min followed by a ramp of 0.3°C/s to 65°C, 65°C for 4 min, final extension of 65°C for 5 min.

All amplifications were carried out using a MJR thermal cycler (Waltham, Massachusetts, USA) for 25-µL reactions containing 1.25 units Taq DNA Polymerase (Roche Applied Science, Mannheim, GER) or 2.5 units Proofstart DNA Polymerase (Qiagen, Valencia, California, USA), 0.2 mM of dNTPs in an equimolar ratio, 10x buffer containing 1.5 mM MgCl2, 0.5–2 µM each primer, and 20–30 ng genomic DNA. Dimethyl sulfoxide (4%) was added to reactions of species that routinely had difficulty amplifying. Polymerase chain reaction products were visualized by agarose gel electrophoresis and cleaned using either a PCR Purification kit (Qiagen) or treatment with shrimp alkaline phosphatase and exonuclease I (ExoSAP; USB Corp., Cleveland, Ohio, USA).

Samples were bidirectionally sequenced at the University of Hawai‘i’s ASGPB Sequencing Facility (http://cgpbr.hawaii.edu/) using BigDye Terminator chemistry (Applied Biosystems, Foster City, California, USA) and visualized on an ABI 3730XL capillary-based DNA sequencer (Applied Biosystems). A few amplified products of ITS that did not directly sequence well were cloned using the Invitrogen TOPO TA Cloning Kit for Sequencing (Carlsbad, California, USA), and 3–5 clones of ~1.2 kb were sequenced. Cloned sequences from an individual were identical.

Sequence alignment and phylogenetic analysis
Contiguous sequences were constructed and edited for all ITS, ETS, ndhF-rpl32, and rpl32-trnL sequences using BioEdit version 7.0.5.3 (Hall, 1999Go). Because of low sequence polymorphism, sequences for each region were easily aligned manually in MacClade version 4.08 (Maddison and Maddison, 2005Go). Individuals within a population with identical sequences for all four gene regions were represented by a single individual in the analysis. Due to difficulty sequencing through A repeats for one individual (P. pachyphylla, Hanawi) in rpl32-trnL, an ~180-bp region of the spacer was input as missing data. The individual was retained in the data set because of low sequence polymorphism in this region and because its inclusion did not appear to influence the analysis.

Indels were coded as missing data in all presented analyses. However, analyses were conducted with and without indels coded as presence/absence characters for each data set using a simple gap coding strategy (Simmons and Ochoterena, 2000Go). Gaps consisting of A and T repeats were not coded given that homology in these areas appeared weak. The data were separated into two major partitions, nuclear (ITS, ETS) and chloroplast (ndhF-rpl32, rpl32-trnL). The data partitions were compared using the incongruence length difference (ILD) test of Farris et al. (1994)Go, implemented as the partition homogeneity test in PAUP* version 4.0b10 (Swofford, 2002Go). For each test, 1000 replicates were performed using heuristic searches, tree-bisection-reconnection (TBR) branch swapping with random addition for three replicates, nchuck = 2, and chuckscore = 1. The ILD tests were done with (1) all individuals included, (2) one discordant individual removed at a time in successive analyses, and (3) groups of discordant individuals removed.

Maximum parsimony (MP), maximum likelihood (ML) and Bayesian methods were used to estimate phylogenies for all three data sets (nuclear, chloroplast and combined). Maximum parsimony and ML searches were conducted using PAUP* 4.0b10 (Swofford, 2002Go), and Bayesian analyses were performed in MrBayes version 3.0b4 (Huelsenbeck and Ronquist, 2001Go). In all MP analyses, heuristic searches were done using a starting tree built from stepwise addition with 1000 random addition replicates and TBR branch swapping. Bootstrap analyses based on 1000 replicates with 10 random additions per replicate were used to assess confidence in clades. Maximum likelihood trees were estimated from heuristic searches started via stepwise addition with 100 random addition replicates and TBR branch swapping. Branch support for ML trees was estimated from 500 bootstrap replicates with five random addition replicates per bootstrap. Evolutionary models were selected by Akaike information criterion (AIC; Akaike, 1974Go) using ModelTest version 3.7 (Posada and Crandall, 1998Go). The models for separate and combined data partitions are as follows: nuclear, TrN+G; chloroplast, TIM+G; combined data set, TIM+I+G. For Bayesian analyses, a mixed model analysis was run so that each gene could evolve under its own best-fit model. Bayesian analyses were run using four incrementally heated chains for 1 000 000 generations and a sampling frequency of 100 generations. Tree samples and parameter estimates from the first 2000 trees were designated as the burn-in period and discarded.

RESULTS

Coded indels
The majority of the informative gaps were not homoplastic when mapped on to the substitution-based gene trees; however, they did not contribute a significant amount of phylogenetic information to any of the data sets. Instead, their inclusion reduced resolution, bootstrap support for clades, and CI levels in the combined analysis. As such, coded indel characters were omitted from all subsequent analyses. The number of coded indels for each gene region and partition are given in Table 2.


View this table:
[in this window]
[in a new window]

 
Table 2. Sequence characteristics for each gene partition.

 
Separate partition analyses
All the gene regions were initially analyzed separately. Numbers of individuals, parsimony informative characters (PICs), and alignment lengths for each region and partition are shown in Table 2. The different gene regions did not vary substantially in the amount of phylogenetic information they contained. Similarly, the nuclear and chloroplast gene partitions did not differ in total number of PICs (41 vs. 42, respectively; Table 2), though more PICs differentiated between members of the ingroup in the chloroplast partition than in the nuclear partition.

Nuclear partition
The alignment of ITS and ETS sequences resulted in 1241 characters; 41 were variable and parsimony informative, and 61 were variable but parsimony uninformative (i.e., autapomorphic; Table 2). The 1000 MP heuristic searches resulted in three trees with length 115 and CI = 0.90. The 100 ML searches using the TrN+G base substitution model produced one tree with score –lnL = 2409.24 and Bayesian analysis resulted in a single consensus tree with score –lnL = 2439.92. Because the three different optimality criteria (MP, ML, and Bayesian) produced phylogenies that were largely concordant, only the ML tree reconstructions are shown here (Fig. 1). Clade support within trees is based on bootstrap values and posterior probabilities where high support is >90%, moderate support 70–90%, and low support <70%.


Figure 1
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 1. Phylogram trees generated by 100 heuristic maximum likelihood searches of the nuclear (ITS and ETS) and chloroplast (rpl32-trnL and ndhF-rpl32) data partitions for Hawaiian Plantago. Above branches are bootstrap values (MP/ML) and below branches are Bayesian posterior probability scores. Log-likelihood scores: nuclear = 2409.24 and chloroplast = 2856.62 (see Methods and Materials for individual data set models). Refer to Table 1 for island abbreviations. NA, North America; NZ, New Zealand. Note: Woodlands refers to forests and shrublands, and bogs include wet ridge tops.

 
The nuclear data set strongly supports the monophyly of Hawaiian Plantago and moderately supports a sister relationship with the western North American species, P. macrocarpa (Bayesian support is high) (Fig. 1). Plantago pachyphylla is paraphyletic as evidenced by the split between the Kaua‘i vs. the O‘ahu and Maui Nui morphotypes. Despite high branch support for these groups, relationships within them were unresolved (support values ≤ 50%; Fig. 1). Monophyly of the woody shrub P. princeps varieties is weakly supported by Bayesian analysis. In general, the three major nrDNA lineages most closely correspond with morphology and habitat type: minute, bog forms from Kaua‘i; woody P. princeps varieties; and herbaceous bog and woodland forms from the younger islands (Fig. 1).

Chloroplast partition
Concatenated sequences of ndhF-rpl32 and rpl32-trnL resulted in 1607 characters; 42 were parsimony informative, while 68 were variable but parsimony uninformative (Table 2). The MP heuristic searches recovered 10 equally parsimonious trees of length 123 and CI = 0.94. The 100 ML searches under the TIM+G model yielded a single tree of score –lnL = 2856.62 and the Bayesian consensus tree had a best score of –lnL = 2885.48. As with the nuclear data, the three analyses produced trees that were largely concordant, and only the ML tree reconstructions are shown (Fig. 1). Monophyly of Hawaiian Plantago is also strongly supported by the chloroplast data set, but in contrast to the nuclear regions, tree reconstructions of the chloroplast partition indicate a sister relationship between the Hawaiian and Rapan taxa; a relationship previously hypothesized by R. K. Hoggard [University of Oklahoma], N. Rønsted [Kew], S. Dunbar-Co [Univ. of Hawai‘i], and P. J. Kores and W.J. Elisens [Univ. of Oklahoma] (unpublished data).

Within the ingroup, there is evidence of two primary clades, though the relationship of these clades to one another is unresolved (Fig. 1). The first clade contains all of the collections from Kaua‘i, except P. princeps var. anomala, and the sole O‘ahu P. pachyphylla morphotype. Plantago princeps var. longibracteata from ‘Ili‘ili‘ula and P. pachyphylla from Sincock Bog are sister to the rest of the Kaua‘i individuals, including a second collection of P. princeps var. longibracteata from Blue Hole, Kaua‘i. The second clade consists of individuals of P. princeps from O‘ahu and Maui, P. pachyphylla from Moloka‘i and Maui, and P. hawaiensis from Hawai‘i. Resolution in this second clade is generally low, and branch support for relationships is weak with the exception of well-supported relationships between the two P. hawaiensis collections, the East Maui collections of P. princeps var. laxifolia (Kipahulu) and P. pachyphylla (Hanawi), and the diverse P. pachyphylla morphotypes from Moloka‘i (in Bayesian analysis). Despite low resolution of the chloroplast phylogeny, these data strongly support paraphyly of P. pachyphylla and P. princeps. In contrast to the nuclear data set, the groupings presented here correspond geographically, where individuals are largely affiliated by region (i.e., island or volcano within island), generally irrespective of taxonomic affiliation, morphology, or habitat type.

Combined analyses
Incongruence length difference tests for the combined matrix revealed that there was a highly significant level of incongruence (P = 0.001) between the nuclear and chloroplast gene partitions. Closer examination revealed that five individuals representing three taxa were primarily responsible for the discordance between data partitions, P. princeps var. longibracteata from Blue Hole and ‘Ili‘ili‘ula on Kaua‘i, P. princeps var. laxifolia from ‘Iao and Kipahulu on Maui, and P. pachyphylla from O‘ahu (Fig. 1). When sequences of all five of these individuals were removed from analyses, the gene partitions were no longer significantly discordant (P > 0.05).

Combining the gene partitions resulted in a better-resolved tree with higher branch support for clades (Fig. 2) than either of the single gene partition analyses. The combined matrix consisted of 2848 characters, 77 of which were parsimony informative (Table 2). The 1000 MP searches resulted in a single best tree of length = 240 and CI = 0.90. Maximum likelihood searches found one tree of score –lnL = 5433.38, and Bayesian searches gave a consensus tree of score –lnL = 5450.71. Maximum parsimony, ML, and Bayesian analyses all produced identical phylogenies, and the Bayesian tree is shown here (Fig. 2). As in the separate partition analyses, there is strong support for the monophyly of Hawaiian Plantago (Fig. 2). Similar to the chloroplast data, a sister relationship between the Hawaiian and Rapan taxa is supported, although ML support of this relationship is weak.


Figure 2
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 2. Bayesian consensus tree for Hawaiian Plantago of the combined data set (ITS, ETS, rpl32-trnL, and ndhF-rpl32) run for 1 million generations with model TIM+I+G and score –lnL = 5450.71. Above branches are bootstrap values (MP/ML) and below branches are Bayesian posterior probability scores. Refer to Table 1 and Fig. 1 for location abbreviations. Note: Woodlands refers to forests and shrublands, and bogs include wet ridge tops.

 
The combined data similarly support the paraphyly of P. pachyphylla and the existence of two major clades among the Hawaiian species (Fig. 2). The first group consists of herbaceous, bog P. pachyphylla morphotypes from Kaua‘i, which is well-resolved with high branch support for clades. In this clade, P. pachyphylla from Sincock Bog is basal, while the more recently derived Kaua‘i morphotypes are from Wainiha and North Bog that occur in the isolated, northern regions of the main Kaua‘i bog system (Alaka‘i). The second clade consists of P. princeps, P. pachyphylla, and P. hawaiensis morphotypes from all of the islands. In this clade, P. princeps var. anomala from Kaua‘i is basal followed by P. princeps varieties from western (Wai‘anae) and eastern O‘ahu (Ko‘olau), respectively. The most derived group in the lineage is a well-supported, albeit poorly resolved, clade containing P. pachyphylla and P. hawaiensis morphotypes from the younger islands of Moloka‘i, Maui, and Hawai‘i.

DISCUSSION

Monophyly of Hawaiian Plantago
The affinities of Hawaiian Plantago have long been debated (Rock, 1920Go; Wagner et al., 1990Go; R. K. Hoggard [University of Oklahoma], N. Rønsted [Kew], S. Dunbar-Co [Univ. of Hawai‘i] and P. J. Kores and W. J. Elisens [Univ. of Oklahoma], unpublished data). Based largely on an apparently erroneous chromosome count by Skottsberg (1955)Go of 2N = 12 for P. princeps, Wagner et al. (1990)Go hypothesized that Hawaiian Plantago may have arisen from two separate dispersal events, one giving rise to the herbaceous P. pachyphylla and P. hawaiensis forms (2N = 24) and the other to the woody P. princeps complex. However, more recent examinations of chromosome number in the group have not been able to replicate Skottsberg’s count, and in fact chromosome counts taken for all species and many populations of Hawaiian Plantago indicate a single tetraploid number of 2N = 4x = 24 (Moore, 1973Go; Kiehn, 2005Go; S. Dunbar-Co and G. D. Carr [Oregon State University], unpublished data). Data presented here confirm that Hawaiian Plantago is monophyletic as evidenced by strong branch support values uniting the Hawaiian taxa relative to the outgroup taxa in all data sets (nuclear, chloroplast, and combined). The sister group to the Hawaiian taxa, on the other hand, is not well resolved. Our nuclear data suggest that the western North American species P. macrocarpa is the closest living relative of the Hawaiian taxa, though the chloroplast and combined data indicate a sister relationship with the Rapan taxa, P. rapensis and P. rupicola. The coastal distribution of P. macrocarpa, shorter distance separating Hawai‘i and North America vs. Hawai‘i and Rapa, and larger size of North America as a source area relative to Rapa, lend support to its sister relationship with the Hawaiian taxa. Additionally, American origins have been found for many Hawaiian plant lineages (Fosberg, 1948Go; Baldwin et al., 1991Go; Howarth et al., 1997Go; Vargas et al., 1998Go; Ballard and Sytsma, 2000Go; Lindqvist et al., 2003Go; Eggens et al., 2007Go). Alternatively, based largely on morphology, affinities between New Zealand and the Hawaiian taxa have been hypothesized (Rock, 1920Go; Rahn, 1996Go; R. K. Hoggard [University of Oklahoma], N. Rønsted [Kew], S. Dunbar-Co [Univ. of Hawai‘i] and P. J. Kores and W. J. Elisens [Univ. of Oklahoma], unpublished data), and a possible dispersal pathway to Hawai‘i could have been from New Zealand via the remote island of Rapa. This dispersal pattern is very similar to that of other Hawaiian plant groups such as Metrosideros (Wright et al., 2001Go), Bidens (Ganders et al., 2000Go), Pittosporum (Gemmill et al., 2002Go), Tetraplasandra (Costello and Motley, 2001Go), and Cyrtandra (Cronk et al., 2005Go) where close relationships between these Hawaiian groups and their Polynesian relatives have been found. Because the data presented here do not fully resolve the relationship between the Hawaiian taxa and these outgroup species, further investigation is necessary to confirm the sister group of Hawaiian Plantago.

Island biogeography of Hawaiian Plantago
A common biogeographical pattern in Hawaiian lineages is initial colonization of the oldest high island, Kaua‘i, followed by dispersal and evolutionary diversification on each new volcano as it became available for colonization (reviewed in Funk and Wagner, 1995Go). Overall, Hawaiian Plantago appears to follow this pattern of progressive, oldest to youngest, island colonization and the combined phylogenetic data unequivocally indicate a Kaua‘i ancestor for the lineage (Figs. 2 and 3). Following establishment on Kaua‘i, there was dispersal to and subsequent diversification on the next oldest volcanoes, Wai‘anae on western O‘ahu (3.7 My) and Ko‘olau on eastern O‘ahu (2.6 My), respectively. From Ko‘olau, Plantago dispersed to one of the younger islands of Moloka‘i, Maui, or Hawai‘i and speciated; however, because relationships among the most recently derived P. pachyphylla and P. hawaiensis morphotypes are unresolved, the dispersal pattern on these younger islands is ambiguous. It is most likely that dispersal proceeded from Ko‘olau to Moloka‘i or Maui and, finally, to Hawai‘i, given that land bridges once connected Ko‘olau to western Moloka‘i and all of the volcanoes comprising the Maui Nui complex (western and eastern Moloka‘i, West and East Maui, Lana‘i, and Kaho‘olawe) to one another (Carson and Clague, 1995Go; Juvik and Juvik, 1998Go). However, it is possible that Plantago dispersed from Ko‘olau directly to the island of Hawai‘i, in which case instances of back dispersal from Hawai‘i to Maui Nui cannot be discounted.


Figure 3
View larger version (24K):
[in this window]
[in a new window]

 
Fig. 3. Biogeographic distribution of Hawaiian Plantago morphotypes included in the combined analysis. In parentheses is island age in millions of years.

 
Relationships and ecological shifts in Hawaiian Plantago
On the basis of the combined analysis (excluding individuals of P. princeps var. longibracteata, P. princeps var. laxifolia, and P. pachyphylla from O‘ahu), there is evidence of a primary division within the Hawaiian Plantago radiation (Fig. 2). This split separates the herbaceous, bog forms on Kaua‘i from the woody and herbaceous forms occurring in woodlands and bogs on all of the islands. At the base of this latter clade are woody P. princeps varieties from Kaua‘i and O‘ahu. Carlquist (1970)Go hypothesized that woodiness in Hawaiian Plantago was a derived trait based on the lack of rays in the secondary xylem and phloem in these taxa. More recent work using molecular data on groups in Hawai‘i and other island systems have confirmed that woodiness is often derived from herbaceous ancestors (e.g., the silversword alliance, Baldwin and Robichaux, 1995Go; Echium, Böhle et al., 1996Go; Pericallis, Panero et al., 1999Go; Hawaiian Viola, Ballard and Sytsma, 2000Go; and Hawaiian Silene, Eggens et al., 2007Go), although woodiness in Hawaiian groups such as Cyanea (Givnish et al., 1995Go) and Psychotria (Nepokroeff et al., 2003Go) has been retained from woody colonizing ancestors. In Hawaiian Plantago, the nuclear and chloroplast phylogenies suggest that woodiness was likely secondarily derived from the herbaceous growth form. Therefore, despite the fact that the combined data set does not resolve the base of the Hawaiian lineage, it is most likely that the ancestral morphotype within the radiation is an herbaceous P. pachyphylla type from Kaua‘i. Additionally, the fact that the herbaceous growth form of these morphotypes is shared with most of the outgroup taxa (P. rupicola is woody) and that these morphotypes occur on the oldest high island (Kaua‘i) further support that the initial Plantago colonist was likely most closely related to a herbaceous, bog P. pachyphylla type from Kaua‘i.

The data suggest that following establishment of Kaua‘i bogs by the herbaceous form there was movement out of the bogs and into neighboring woodland habitats. This habitat shift was seemingly accompanied by the development of woodiness and the derivation of the woody, Kaua‘i endemic, P. princeps var. anomala. The combined data indicate that this taxon or its ancestor then dispersed to woodland habitats on the next younger volcanoes of Wai‘anae, then Ko‘olau and gave rise to P. princeps var. princeps. There seems to have then been a reversion back to the herbaceous growth form in the most recently derived clade of Hawaiian Plantago, which consists of herbaceous morphotypes from the younger islands of Moloka‘i, Maui, and Hawai‘i. This shift in growth form may have been mediated by the availability of bog habitats on these younger islands. Unlike the herbaceous forms on Kaua‘i, a few of these more recently derived herbaceous morphotypes, such as P. pachyphylla from Pu‘u Kukui forest and P. hawaiensis from Maunaiu (Table 1), occur largely in woodland habitats, a condition they may have retained from their woody progenitors. Despite differences in habitat, these later-derived, herbaceous forms represent a well-supported clade (Fig. 2); however, relationships among them are not clearly resolved, a result likely due to the recent and rapid diversification of these forms (cf. Baldwin et al., 1990Go; cf. Baldwin and Sanderson, 1998Go). Despite this, within the clade there is strong support that single dispersal events gave rise to the diverse Moloka‘i P. pachyphylla forms (low support based on MP and ML) and P. hawaiensis forms on the island of Hawai‘i. The Maui forms of P. pachyphylla do not form a monophyletic group and their relationship to both the Moloka‘i and Hawai‘i morphotypes is not clear.

Overall, the data suggest a relationship between growth form and habitat type in Hawaiian Plantago with herbaceous P. pachyphylla and P. hawaiensis forms restricted to open bogs and wet ridge tops, while woody P. princeps varieties are primarily found in woodland habitats (Fig. 4). Habitat shifts between bog and woodland habitats, with accompanying changes in growth form and secondary structure, appear to be a major driver of speciation in intraisland species radiations in Hawaiian Plantago, which is a common trend in Hawaiian plant adaptive radiations (Carlquist, 1974Go; Funk and Wagner, 1995Go; Price and Wagner, 2004Go). In the case of interisland dispersal, it is probable that isolation is great enough to allow for diversification without habitat shifts, and the data presented here do not refute this hypothesis.


Figure 4
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 4. Reconstruction of ancestral states mapped onto Bayesian consensus tree of the combined data set for Hawaiian Plantago. (A) Habitat (white = open bogs; black = woodlands; gray = coastal; dashed = unknown). (B) Growth form (white = herbaceous; black = woody).

 
Hybridization within Hawaiian Plantago
Unlike the other Hawaiian Plantago morphotypes, individuals of P. princeps var. longibracteata, P. princeps var. laxifolia, and P. pachyphylla (O‘ahu) demonstrated incongruence among the nuclear and chloroplast gene trees. This evidence, combined with the high interfertility, wind pollination, and largely protogynous breeding system of Hawaiian Plantago taxa (Rahn, 1996Go; S. Dunbar-Co, personal observation), strongly suggest hybridization among these species.

Plantago princeps var. longibracteata is a woody, prostrate subshrub whose admixture of morphological traits and novel riparian habitat have led researchers in the past to postulate its hybrid origins (Table 1; Wagner et al., 1990Go). The unique characteristics of this taxon in combination with the fact that it is fully fertile suggest that it should be considered a distinct species. Although endemic to Kaua‘i and O‘ahu, the only known extant populations of this endangered taxon are found on Kaua‘i where they occur along waterfalls in the northeastern valleys that extend from the Alaka‘i bog region and nearby Mt. Wai‘ale‘ale summit. Nuclear data place individuals of P. princeps var. longibracteata in the entirely P. princeps clade, while the chloroplast data firmly resolves them in the largely Kaua‘i P. pachyphylla clade. These data, in combination with morphological, ecological, and reproductive characteristics, suggest that P. princeps var. longibracteata arose via homoploid hybrid speciation (Rieseberg, 1997Go). The putative parental types of this taxon are the woody shrub P. princeps var. anomala and an herbaceous P. pachyphylla form, both of which occur in the Alaka‘i area. Gene flow between these taxa may have been considerable in the past given the close proximity of woodland and bog habitats in this area and these species’ breeding and pollination systems. Additionally, these taxa may have frequently been in contact until recently, before their severe reduction by feral ungulates in the latter part of the 1900s (USFWS, 1999Go).

Unlike P. princeps var. longibracteata, the morphological and ecological characteristics of the two other taxa are products of extensive gene flow via introgressive hybridization (Rieseberg, 1997Go). Nuclear data places O‘ahu plants of P. pachyphylla in the clade containing Maui Nui and Hawai‘i P. pachyphylla and P. hawaiensis individuals, though the chloroplast data strongly supports its inclusion in the Kaua‘i P. pachyphylla clade. We suggest that this result is due to initial derivation of this morphotype from an ancestral Kaua‘i P. pachyphylla type followed by more recent gene flow with morphotypes of P. pachyphylla from the younger islands of Moloka‘i and Maui.

The phylogenetic pattern exhibited by individuals of P. princeps var. laxifolia from ‘Iao (West Maui) and Kipahulu (East Maui) similarly suggests contemporary gene flow with nearby P. pachyphylla morphotypes. The nuclear data place the ‘Iao and Kipahulu individuals in a clade containing the other P. princeps taxa while the chloroplast data has them grouped with neighboring Pu‘u Kukui (West Maui) and Hanawi (East Maui) P. pachyphylla forms, respectively. The data suggest that P. princeps var. laxifolia evolved from P. princeps var. princeps following dispersal of this taxon from Ko‘olau to Maui Nui. The occurrence of populations of P. princeps var. laxifolia in the valleys directly below the mountain summits where P. pachyphylla populations are found, in combination with the high interfertility and reproductive systems of these taxa, insinuate that gene flow between them may have been common in the past when P. princeps var. laxifolia was more widespread than today (USFWS, 1999Go).

Taxonomic issues in Hawaiian Plantago
Hawaiian Plantago encompasses a range of habitats, growth forms, vegetative structures, and reproductive features, and this diversity has led to a lack of consensus regarding the group’s taxonomy (Gray, 1862Go; Hillebrand, 1888Go; Rock, 1920Go; Pilger, 1923Go, 1936Go, 1937Go; Skottsberg, 1944Go; Wagner et al., 1990Go). Data presented here suggest that the current treatment by Wagner et al. (1990)Go, recognizing three endemic species and four varieties, underrepresents diversity in the group. We found strong evidence that P. pachyphylla is paraphyletic, with morphotypes from Kaua‘i forming a clade separate from those found on the younger islands. Within these clades, there is evidence of genetic divergence among P. pachyphylla morphotypes (see chloroplast and combined analyses), which, when corroborated by morphological, ecological, and geographic data, may be great enough to warrant their taxonomic separation. Additional taxonomic issues concern the P. princeps complex, particularly classification of P. princeps var. longibracteata. As previously noted, this taxon’s unique morphology, novel habitat, fertility, and probable hybrid origins likely warrant elevating it to the species level, following Pilger’s (1923)Go classification. Furthermore, we found evidence of genetic divergence among Wai‘anae and Ko‘olau populations of the endangered P. princeps var. princeps, despite the fact that they are morphologically indistinguishable. It is possible that these populations represent cryptic or incipient species, a finding that would have significant conservation implications. Taken together, the taxonomic inconsistencies brought to light by this work necessitated taxonomic revisions, which are presently underway and to be published separately.

Conclusions
The apparent monophyly of Hawaiian Plantago along with its morphological and ecological diversity suggest that it is yet another example of adaptive radiation in the Hawaiian flora. Common patterns in Hawaiian plant adaptive radiations such as progressive, oldest to youngest, island colonization, allopatric speciation subsequent to interisland dispersal events and intraisland habitat shifts, and woodiness derived in situ from herbaceous ancestors have now been extended to Hawaiian Plantago, previously a relatively unknown and understudied group of Hawaiian plants. A novel finding from these results is the suggestion that a reversion from woodiness back to herbaceousness may have taken place, and if further substantiated, this would be unprecedented among adaptive radiation lineages in Hawai‘i. This work further suggests that hybridization has played an important role in the evolutionary history of this lineage as it has in many other lineages within the Hawaiian Islands (Carr and Kyhos, 1986Go; Koutnik, 1990Go; Wagner et al., 1990Go; Howarth and Baum, 2005Go). Lastly, analyses presented here have confirmed the morphological complexity and reinforced the need for taxonomic revision of Hawaiian Plantago, a finding that will likely be extended to many other Hawaiian plant groups as studies of this nature become more frequent.

Appendix 1. List of taxa used in this study, voucher information, and GenBank accession numbers for the four regions studied. Missing data are indicated with a dash (—). The following abbreviations are used for herbaria: BISH = Bishop Museum, PTBG = National Tropical Botanical Garden, OSC = Oregon State University, NY = New York Botanical Garden, WELTU = Victoria University.


View this table:
[in this window]
[in a new window]

 
 

FOOTNOTES

1 The authors thank M. Bruegmann, V. Caraway, P. Garnock-Jones, R. Hoggard, D. Lorence, T. Motley, H. Oppenheimer, and M. Schultz for kindly sending specimens; and A. Bakutis, K. Bio, K. Dunbar, M. LeGrande, A. Medeiros, H. Oppenheimer, S. Perlman, N. Tangalin, J. TenBruggencate, and the O‘ahu Army Natural Resources Program for assistance in the field. We also thank the Hawai‘i State Department of Forestry and Wildlife, U. S. Fish and Wildlife Service, Haleakala National Park, Hawai‘i Volcanoes National Park, The Nature Conservancy of Hawai‘i, and Maui Land and Pineapple Co. for the access and permits required to do this work. The following herbaria generously provided material for this study: ALTA, BISH, HAW, MOT, PTBG, OSC, NY, UBC and WELTU. Helpful comments on this manuscript were provided by G. Carr, S. Conant, D. Drake, Z. Forsman, D. Lorence, M. Nepokroeff, and T. Ranker. This work was funded by an Environmental Protection Agency Graduate Fellowship and a University of Hawai‘i Oiwi Ake Akamai Doctoral Completion Fellowship awarded to S.D-C. Back

4 Author for correspondence (e-mail: sdunbar{at}hawaii.edu) Back

LITERATURE CITED

Akaike, H. 1974. A new look at statistical model identification. IEEE Transactions on Automatic Control 19: 716–723.[CrossRef]

Andreasen, K., AND B. G. Baldwin. 2001. Unequal evolutionary rates between annual and perennial lineages of checker mallows (Sidalcea, Malvaceae): Evidence from 18S-26S rDNA internal and external transcribed spacers. Molecular Biology and Evolution 18: 936–944.[Abstract/Free Full Text]

Baldwin, B. G. 1997. Adaptive radiation of the Hawaiian silversword alliance: Congruence and conflict of phylogenetic evidence from molecular and non-molecular investigations. In T. J. Givnish, and K. J. Sytsma [eds.], Molecular evolution and adaptive radiation, 103–128. Cambridge University Press, Cambridge, UK.

Baldwin, B. G., D. W. Kyhos, AND J. Dvorak. 1990. Chloroplast DNA evolution and adaptive radiation in the Hawaiian silversword alliance (Asteraceae-Madiinae). Annals of the Missouri Botanical Garden 77: 96–109.[CrossRef][Web of Science]

Baldwin, B. G., D. W. Kyhos, J. Dvorak, AND G. D. Carr. 1991. Chloroplast DNA evidence for a North American origin of the Hawaiian silversword alliance (Asteraceae). Proceedings from the American Academy of Sciences USA 88: 1840–1843.

Baldwin, B. G., AND S. Markos. 1998. Phylogenetic utility of the external transcribed spacer (ETS) of 18S-26S rDNA: Congruence of ETS and ITS trees of Calycadenia (Compositae). Molecular Phylogenetics and Evolution 10: 449–463.[CrossRef][Web of Science][Medline]

Baldwin, B. G., AND R. H. Robichaux. 1995. Historical biogeography and ecology of the Hawaiian silversword alliance (Asteraceae): New molecular phylogenetic perspectives. In W. L. Wagner, and V. A. Funk [eds.], Hawaiian biogeography: Evolution on a hotspot archipelago, 259–287. Smithsonian Institution Press, Washington, D.C. USA.

Baldwin, B. G., AND J. M. Sanderson. 1998. Age and rate of diversification of the Hawaiian silversword alliance (Compositae). Proceedings of the National Academy of Sciences, USA 95: 9402–9406.[Abstract/Free Full Text]

Baldwin, B. G., J. M. Sanderson, J. M. Porter, C. S. Wojciechowski, C. S. Campbell, AND M. J. Donoghue. 1995. The ITS region of nuclear ribosomal DNA: A valuable source of evidence on angiosperm phylogeny. Annals of the Missouri Botanical Garden 82: 247–277.[CrossRef][Web of Science]

Ballard, H. E., AND K. J. Sytsma. 2000. Evolution and biogeography of the woody Hawaiian violets (Viola, Violaceae): Arctic origins, herbaceous ancestry and bird dispersal. Evolution 54: 1521–1532.[Web of Science][Medline]

Böhle, U., H. H. Hilger, AND W. F. Martin. 1996. Island colonization and evolution of the insular woody habit in Echium L. (Boraginaceae). Proceedings of the National Academy of Sciences, USA 93: 11740–11745.[Abstract/Free Full Text]

Carlquist, S. 1970. Wood anatomy of insular species of Plantago and the problem of raylessness. Bulletin of the Torrey Botanical Club 97: 353–361.[CrossRef][Web of Science]

Carlquist, S. 1974. Island biology. Columbia University Press, New York, New York, USA.

Carlquist, S. 1980. Hawaii: A natural history. Pacific Tropical Botanical Garden, Lawai, Hawaii, USA.

Carlquist, S., B. G. Baldwin, AND G. D. Carr. 2003. Tarweeds and silverswords: Evolution of the Madiinae (Asteraceae). Missouri Botanical Garden Press, St. Louis, Missouri, USA.

Carr, G. D., AND D. W. Kyhos. 1986. Adaptive radiation in the Hawaiian silversword alliance (Compositae-Madiinae). II. Cytogenetics of artificial and natural hybrids. Evolution 40: 959–976.[CrossRef][Web of Science]

Carson, H. L., AND D. A. Clague. 1995. Geology and biogeography of the Hawaiian Islands. In W. L. Wagner, and V. A. Funk [eds.], Hawaiian biogeography: Evolution on a hotspot archipelago, 14–29. Smithsonian Institution Press, Washington, D.C. USA.

Costello, A., AND T. J. Motley. 2001. Molecular sytematics of Tetraplasandra, Munroidendronand Reynoldsia sandwicensis (Araliaceae) and the evolution of superior ovaries in Tetraplasandra. Edinburgh Journal of Botany 58: 229–242.[CrossRef]

Cronk, Q. C. B., M. Kiehn, W. L. Wagner, AND J. F. Smith. 2005. Evolution of Cyrtandra (Gesneriaceae) in the Pacific Ocean: The origin of a supertramp clade. American Journal of Botany 92: 1017–1024.[Abstract/Free Full Text]

Darwin, C. 1859. On the origin of species. John Murray, London, UK.

Downie, S. R., AND D. S. Katz-Downie. 1996. A molecular phylogeny of Apiaceae subfamily Apioideae: Evidence from nuclear ribosomal DNA internal transcribed spacer sequences. American Journal of Botany 83: 234–251.[CrossRef][Web of Science]

Doyle, J. J., AND J. L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15.

Dunbar-Co, S., M. J. Sporck, AND L. Sack. In press. Leaf trait diversification and design in seven rare taxa of the Hawaiian Plantago radiation. International Journal of Plant Sciences.

Eggens, F., M. Popp, M. Nepokroeff, W. L. Wagner, AND B. Oxelman. 2007. The origin and number of introductions of the Hawaiian endemic Silene species (Caryophyllaceae). American Journal of Botany 94: 210–218.[Abstract/Free Full Text]

Farris, J. S., M. Källersjö, A. G. Kluge, AND C. Bult. 1994. Testing significance of incongruence. Cladistics 10: 315–319.[CrossRef][Web of Science]

Fosberg, F. R. 1948. Derivation of the flora of the Hawaiian Islands. In E. C. Zimmerman [ed.], Insects of Hawaii, 107–119. University of Hawaii Press, Honolulu, Hawaii, USA.

Funk, V. A., AND W. L. Wagner. 1995. Biogeography of seven ancient Hawaiian plant lineages. In W. L. Wagner, and V. A. Funk [eds.], Hawaiian biogeography: Evolution on a hotspot archipelago, 160–194. Smithsonian Institution Press, Washington, D.C. USA.

Ganders, F. R., M. Berbee, AND M. Pirseyedi. 2000. ITS base sequence phylogeny in Bidens (Asteraceae): Evidence for continental relatives of Hawaiian and Marquesan Bidens. Systematic Botany 25: 122–133.[CrossRef][Web of Science]

Geiger, J. M. O., AND T. A. Ranker. 2005. Molecular phylogenetics and historical biogeography of Hawaiian Dryopteris (Dryopteridaceae). Molecular Phylogenetics and Evolution 34: 392–407.[CrossRef][Web of Science][Medline]

Gemmill, C. E. C., G. J. Allan, W. L. Wagner, AND E. A. Zimmer. 2002. Evolution of insular Pacific Pittosporum (Pittosporaceae): Origin of the Hawaiian radiation. Molecular Phylogenetics and Evolution 22: 31–42.[CrossRef][Web of Science][Medline]

Givnish, T. J., K. J. Sytsma, J. F. Smith, AND W. J. Hahn. 1995. Molecular evolution, adaptive radiation, and geographic speciation in Cyanea (Campanulaceae, Lobelioideae). In W. L. Wagner, and V. A. Funk [eds.], Hawaiian biogeography: Evolution on a hotspot archipelago, 288–336. Smithsonian Institution Press, Washington, D.C. USA.

Gray, A. 1862. Characters of some new or obscure species of plants, of monopetalous orders, in the collection of the United States South Pacific exploring expedition under Captain Charles Wilkes. Proceedings of the American Academy of Arts and Sciences 6: 53–55.

Hall, T. A. 1999. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NY. Nucleic Acids Symposium Series 41: 95–98.

Helenurm, K., AND F. R. Ganders. 1985. Adaptive radiation and genetic differentiation in Hawaiian Bidens. Evolution 39: 753–765.[CrossRef][Web of Science]

Hillebrand, W. 1888. Flora of the Hawaiian Islands: A description of their phanerograms and vascular cryptograms. Hafner Publishing, New York, New York, USA.

Howarth, D. G., AND D. A. Baum. 2005. Genealogical evidence of homoploid hybrid speciation in an adaptive radiation of Scaevola (Goodeniaceae) in the Hawaiian Islands. Evolution 59: 948–961.[CrossRef][Web of Science][Medline]

Howarth, D. G., D. E. Gardner, AND C. W. Morden. 1997. Phylogeny of Rubus subgenus Idaeobatus (Rosaceae) and its implications toward colonization of the Hawaiian Islands. Systematic Botany 22: 433–441.[CrossRef][Web of Science]

Huelsenbeck, J. P., AND F. Ronquist. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics (Oxford, England) 17: 754–755.[CrossRef]

Juvik, S. P., AND J. O. Juvik. 1998. Atlas of Hawaii. University of Hawaii Press, Honolulu, Hawaii, USA.

Kiehn, M. 2005. Chromosome numbers of Hawaiian angiosperms: New records and comments. Pacific Science 59: 363–377.[CrossRef]

Koutnik, D. L. 1990. Chamaesyce (native species). In W. L. Wagner, D. R. Herbst, and S. H. Sohmer [eds.], Manual of flowering plants of Hawaii, 602–615. University of Hawaii Press and Bishop Museum Press, Honolulu, Hawaii, USA.

Linder, C. R., L. R. Goertzen, B. V. Heuvel, J. Francisco-Ortega, AND R. K. Jansen. 2000. The complete external transcribed spacer of 18S-26S rDNA: Amplification and phylogenetic utility at low taxonomic levels in Asteraceae and closely allied families. Molecular Phylogenetics and Evolution 14: 285–303.[CrossRef][Web of Science][Medline]

Lindqvist, C., T. J. Motley, J. J. Jeffrey, AND V. A. Albert. 2003. Cladogenesis and reticulation in the Hawaiian endemic mints (Lamiaceae). Cladistics 19: 480–495.[CrossRef][Web of Science]

Maddison, D. R., AND W. P. Maddison. 2005. MacClade version 4. 08. Sinauer, Sunderland, Massachusetts, USA.

Markos, S., AND B. G. Baldwin. 2001. Higher-level relationships and major lineages of Lessingia (Compositae, Astereae) based on nuclear rDNA internal and external transcribed spacer (ITS and ETS) sequences. Systematic Botany 26: 168–183.[Web of Science]

Moore, R. J. 1973. Index to plant chromosome numbers. Regnum Vegetabile 90: 1–530.

Morden, C. W., V. Caraway, AND T. J. Motley. 1996. Development of a DNA library for native Hawaiian plants. Pacific Science 50: 324–335.

Nepokroeff, M., K. J. Sytsma, W. L. Wagner, AND E. A. Zimmer. 2003. Reconstructing ancestral patterns of colonization and dispersal in the Hawaiian understory genus Psychotria (Rubiaceae): A comparison of parsimony and likelihood approaches. Systematic Biology 52: 820–838.[CrossRef][Web of Science][Medline]

Panero, J. L., J. Francisco-Ortega, R. K. Jansen, AND A. Santos-Guerra. 1999. Molecular evidence for multiple origins of woodiness and a New World biogeographic connection of the Macaronesian Island endemic Pericallis (Asterceae: Senecioneae). Proceedings of the National Academy of Sciences, USA 96: 13886–13891.[Abstract/Free Full Text]

Pilger, R. 1923. Beitrage zur Kenntnis der Gattung Plantago. Repertorium Specierum Novarum Regni Vegetabilis 19: 114–119.

Pilger, R. 1936. Drei neue Arten von Plantago aus der Verwandtschaft von P. pachyphylla Gray. Repertorium Specierum Novarum Regni Vegetabilis 40: 237–239.

Pilger, R. 1937. Plantaginaceae. Das Pflanzenreich IV: 1–466 Wilhelm Englemann, Leipzig, Germany.

Posada, D., AND K. A. Crandall. 1998. MODELTEST: Testing the model of DNA substitution. Bioinformatics (Oxford, England) 14: 817–818.[CrossRef]

Price, J. P., AND W. L. Wagner. 2004. Speciation in Hawaiian angiosperm lineages: Cause, consequence, and mode. Evolution 58: 2185–2200.[Web of Science][Medline]

Rahn, K. 1996. A phylogenetic study of the Plantaginaceae. Botanical Journal of the Linnean Society 120: 145–198.[Web of Science]

Randell, R. A., AND C. W. Morden. 1999. Hawaiian plant DNA library II: Endemic, indigenous, and introduced species. Pacific Science 53: 401–417.

Rieseberg, L. H. 1997. Hybrid origins of plant species. Annual Review of Ecology and Systematics 28: 359–389.[CrossRef][Web of Science]

Rieseberg, L. H., AND D. E. Soltis. 1991. Phylogenetic consequences of cytoplasmic gene flow in plants. Evolutionary Trends in Plants 5: 65–84.[Web of Science]

Rock, J. F. 1920. The genus Plantago in Hawaii. American Journal of Botany 7: 195–210.[CrossRef][Web of Science]

Sakai, A. K., S. G. Weller, W. L. Wagner, M. Nepokroeff, AND T. M. Culley. 2006. Adaptive radiation and evolution of breeding systems in Schiedea (Caryophyllaceae), an endemic Hawaiian genus. Annals of the Missouri Botanical Garden 93: 49–63.[CrossRef][Web of Science]

Sang, T., AND Y. Zhong. 2000. Testing hybridization hypotheses based on incongruent gene trees. Systematic Biology 49: 422–434.[Abstract/Free Full Text]

Shaw, J., E. B. Lickey, E. E. Schilling, AND R. L. Small. 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: The tortoise and the hare III. American Journal of Botany 94: 275–288.[Abstract/Free Full Text]

Simmons, M. P., AND H. Ochoterena. 2000. Gaps as characters in sequence-based phylogenetic analyses. Systematic Biology 49: 369–381.[Free Full Text]

Skottsberg, C. 1944. Vascular plants from the Hawaiian Islands. IV. Acta Horti Gothoburgensis 15: 450–462.

Skottsberg, C. 1955. Chromosome numbers in Hawaiian flowering plants. Arkiv for Botanik 3: 63–70.

Swofford, D. L. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods). Sinauer, Sunderland, Massachusetts, USA.

Timme, R. E., B. B. Simpson, AND C. R. Linder. 2007. High-resolution phylogeny for Helianthus (Asteraceae) using the 18S-26S ribosomal DNA external transcribed spacer. American Journal of Botany 94: 1837–1852.[Abstract/Free Full Text]

USFWS [U.S. Fish and Wildlife Service]. 1999. Recovery plan for multi-island plants. U.S. Fish and Wildlife Service, Portland, Oregon, USA.

Vargas, P., B. G. Baldwin, AND L. Constance. 1998. Nuclear ribosomal DNA evidence for a western North American origin of Hawaiian and South American species of Sanicula (Apiaceae). Proceedings of the National Academy of Sciences, USA 95: 235–240.[Abstract/Free Full Text]

Wagner, W. L., D. R. Herbst, AND S. H. Sohmer. 1990. Manual of flowering plants of Hawaii. University of Hawaii Press and Bishop Museum Press, Honolulu, Hawaii, USA.

White, T. J., T. D. Bruns, S. B. Lee, AND J. W. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White [eds.], PCR protocols: A guide to methods and applications, 315–322. Academic Press, San Diego, California, USA.

Wright, S. D., C. G. Yong, S. R. Wichman, J. W. Dawson, AND R. C. Gardner. 2001. Stepping stones to Hawaii: A trans-equatorial dispersal pathway for Metrosideros (Myrtaceae) inferred from nrDNA (ITS + ETS). Journal of Biogeography 28: 769–774.[CrossRef][Web of Science]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Am. J. Bot.Home page
N. Ishikawa, J. Yokoyama, and H. Tsukaya
Molecular evidence of reticulate evolution in the subgenus Plantago (Plantaginaceae)
Am. J. Botany, September 1, 2009; 96(9): 1627 - 1635.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dunbar-Co, S.
Right arrow Articles by Morden, C. W.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Dunbar-Co, S.
Right arrow Articles by Morden, C. W.
Agricola
Right arrow Articles by Dunbar-Co, S.
Right arrow Articles by Morden, C. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS