|
|
||||||||
|
(American Journal of Botany. 2008;95:1297-1306.) doi: 10.3732/ajb.0800187 © 2008 Botanical Society of America, Inc. |
What's this? |
Systematics and Phytogeography |
Department of Biology, Ludwig-Maximilians-University Munich, Menzinger Strasse 67, D-80638 Munich, Germany
Received for publication 5 June 2008. Accepted for publication 22 July 2008.
ABSTRACT
Correnss 1903 (Berichte der Deutschen Botanischen Gesellschaft 21: 133–147) crosses between a monoecious and a dioecious species of Bryonia revealed the simple Mendelian inheritance of dioecy and provided the first instance of an XY sex determination system in any organism. Bryonia ranges from the Canary Islands to Central Asia and comprises seven dioecious and three monoecious species; its closest relative, Ecballium elaterium, has dioecious and monoecious populations. We used chloroplast (cp) and nuclear (nr) gene phylogenies to infer sexual system evolution in Bryonia. We also tested for associations between sexual system and ploidy level, based on published and original chromosome counts. Conflicts between cp and nr topologies imply that the dioecious hexaploid B. cretica arose from hybridization(s), probably involving the dioecious diploids B. dioica, B. syriaca, and/or B. multiflora. A tetraploid dioecious endemic on Corsica and Sardinia probably originated from B. dioica via autopolyploidy. While the cp phylogeny resolves few species relationships, the nr tree implies at least two evolutionary changes in sexual system. There is no correlation between sexual system and ploidy level. Molecular clocks suggest that the deepest divergence, between a species on the Canary Islands and the ancestor of all remaining species, occurred ca. 10 million years ago.
Key Words: Bryonia chloroplast DNA haplotypes chromosome counts Cucurbitaceae dioecy hybridization monoecy nuclear LEAFY intron polyploidy
The first experimental system for the genetics of sex determination was the Cucurbitaceae genus Bryonia (Correns, 1903
, 1907
; Rheinberger, 2000
). From the sex ratios of almost 1000 offspring from reciprocal pollinations between dioecious B. dioica and monoecious B. alba, Correns inferred that half the pollen grains of B. dioica carried a "female tendency," the other half a "male tendency." Because of the importance of this discovery, Bateson (1909)
repeated Correnss experiments, with the same results. Later studies used B. dioica and B. aspera as an additional dioecious/monoecious pair for reciprocal crossing (Heilbronn and Basarman, 1942
; Heilbronn, 1953
; summarized in Westergaard, 1958
). These experiments confirmed XY sex determination, with the male the heterogametic sex. The sister group to Bryonia is the Mediterranean genus Ecballium (Kocyan et al., 2007
), which comprises a single species that can be dioecious or monoecious (E. elaterium subsp. dioicum and subsp. elaterium). The dioecious subspecies of Ecballium has XY sex determination, with the males again the heterogametic sex (Galán, 1946
; Westergaard, 1958
). Transplant and common garden experiments in Spain have shown that dioecious populations are better adapted to water stress than monoecious ones (Costich and Galán, 1988
; Costich and Meagher, 1992
; Costich, 1995
). Together, Bryonia and Ecballium provide an exceptional system in which to study the evolution of XY sex determination and the evolution of dioecy and monoecy.
A taxonomic treatment of Bryonia accepts 12 species (Jeffrey, 1969
), two of them with considerable doubt, and a phylogeographic analysis of chloroplast and nuclear data suggests that there are 10 biological species (S. Volz and S. Renner, in press
). Of these, seven are dioecious, three monoecious (references for each species sexual system are provided in Materials and Methods). On the basis of herbarium specimens, Jeffrey (1969)
suggested that two normally monoecious species might be dioecious in parts of their range; they are B. alba, which ranges from Central Europe to Kazakhstan and B. monoica, which occurs in Afghanistan, Tajikistan, Kazakhstan, and Uzbekistan. However, distinguishing dioecy from monoecy based on herbarium specimens alone is problematic because incomplete collections of these climbing species may easily suggest unisexuality.
Because experimental interspecific crosses result in fertile progeny (as shown by the Mendelian studies described above), the question arises if natural hybridization is an important factor in the evolution of Bryonia. Hybridization might explain why some species of Bryonia can be difficult to distinguish from each other. For example, individuals of B. cretica and B. multiflora from Turkey are difficult to separate and so are some specimens of B. cretica and B. dioica (Jeffrey, 1969
; S. Volz, personal observation). However, difficulties in species identification in Bryonia might also be an artifact because herbarium material may not show features, such as fruit color and stigma pubescence, that are important species characters in this genus (Jeffrey, 1969
). Molecular sequences can be a powerful tool to assign individuals to natural gene pools and to identify hybrid individuals, provided that within-species sampling is sufficiently dense and that the nuclear and organelle loci chosen evolve at suitable speeds (Rieseberg and Wendel, 1993
; Sang et al., 1997
).
Transitions between monoecy and dioecy may correlate with polyploidy. For example, dioecy appears to break down in polyploid populations of Empetrum: The diploid E. nigrum var. nigrum is dioecious, while the polyploid var. hermaphroditum is hermaphroditic (Westergaard, 1958
). Also in Mercurialis annua, the diploid forms are dioecious, while polyploid forms are monoecious or androdioecious (Durand and Durand, 1992
; Pannell et al., 2004
, 2008
; but see Obbard et al., 2006
for exceptions). A possible mechanism could be that some forms of nuclear-determined dioecy may break down in polyploids because of dosage imbalances (Westergaard, 1958
; Smith, 1969
; Pannell et al., 2004
). However, there are polyploid dioecious species of Rumex (Polygonaceae; Smith, 1969
), Lycium (Solanaceae; Miller and Venable, 2000
; Yeung et al., 2005
), and Fragaria (Rosaceae; Westergaard, 1958
). Indeed, a positive association between polyploidy and dioecy might be favored by the frequent breakdown of self-incompatibility in recent polyploids, which in turn might select for dioecy as an alternative outcrossing mechanism (Miller and Venable, 2000
). This proposed explanation does not fully match the observed pattern, however, because Mercurialis and Rumex are self-compatible, while Empetrum nigrum, Lycium, and Fragaria are self-incompatible. As far as known, Cucurbitaceae do not possess genetic self-incompatibility (Rubino and Wehner, 1986
).
Here we employ nuclear and chloroplast sequences from a dense sample of individuals representing all accepted species of Bryonia (with multiple accessions) to examine species relationships, hybridization, and the evolution of monoecy and dioecy. To determine if ploidy levels correlate with monoecy or dioecy, we augmented published chromosome counts for the genus by new counts from wild-collected material.
MATERIALS AND METHODS
Taxon sampling, range mapping, and sexual systems
The phylogenetic relationships of Bryonia and Ecballium within Cucurbitaceae have been tested with sequence data for 236 species from most of the familys genera (Kocyan et al., 2007
; Schaefer et al., 2008
). In these studies, Bryonia was represented by three species spanning the root of the genus: B. alba, B. dioica, and B. verrucosa. The closest relative of Bryonia and Ecballium turned out to be the Australian genus Austrobryonia, all four species of which are monoecious (Schaefer et al., 2008
). Biogeographically, the Bryonia-Ecballium clade results from a dispersal event from Asia into the Mediterranean sometime in the Eocene (H. Schaefer, C. Heibl, and S. S. Renner, unpublished manuscript). On the basis of these findings, we rooted the Bryonia trees on Ecballium and one species of Austrobryonia.
Our sampling of Bryonia covers the geographic range and morphological diversity of the species; 123 of the 135 total DNA extracts generated came from herbarium specimens (up to 124 yr old). Information on sexual systems comes from the observation of living plants of B. alba, B. cretica, B. dioica, and B. verrucosa, and from the following references: Dioecious species are B. acuta (Jeffrey, 1969
), B. cretica (Jeffrey, 1969
; Feinbrun, 1978
), B. dioica (Correns, 1903
, Correns, 1907
), B. marmorata (Jeffrey, 1969
; Chiappini, 1985
), B. multiflora (Heilbronn and Basarman, 1942
; Heilbronn, 1953
), B. syriaca (Rottenberg, 2000
, three populations and 134 individuals were studied), and B. verrucosa (Jeffrey, 1969
). Monoecious species are B. alba (Correns, 1903
, Correns, 1907
; Heilbronn and Basarman, 1942
; Jeffrey, 1969
), B. aspera (Bilge, 1955
, under the synonymous name B. macrostylis Heilbronn and Bilge, 1954
), and B. monoica (Vassilczenko, 1957
; Jeffrey, 1969
).
DNA isolation, amplification, and sequencing
Total DNA was isolated from silica-gel-dried leaves or herbarium material using the NucleoSpin Plant Kit (Macherey-Nagel, Düren, Germany) according to the manufacturers protocol. DNA concentration and quality were checked on 1% agarose gels by electrophoresis using lambda DNA as a reference. Polymerase chain reactions (PCR) were performed with 10 µM of primers, 25 µM MgCl2, 1.25 µM of each dNTP, 1x PCR buffer, 0.5 units of Taq DNA polymerase (New England Biolabs, Frankfurt am Main, Germany), and 10–50 ng of template DNA per 25 µl reaction. PCR reactions were set at an initial 5 min at 95°C, followed by 35 cycles of 95°C for 30 s for DNA denaturation, 30 s for primer annealing at a temperature appropriate for the specific primer pair, and 72°C for 1 min for primer extension; with a final elongation period at 72°C for 7 min to complete all primer extensions.
The trnL intron and trnL-trnF intergenic spacer (IGS) were amplified using the Taberlet et al., (1991)
primers c, d, e, and f, and an annealing temperature of 55°C. The psbA-trnH spacer was amplified at the same annealing temperature with the forward primer of Sang et al. (1997)
and the trnH2 reverse primer 5' CGCGCATGGTGGATTCACAATCC 3' (developed by C. Heibl). The trnR-atpA spacer was amplified with the forward and reverse primers of Chung et al. (2003)
. For Austrobryonia, we used the primer pair ccSSr4 F2 (5' AAATTTCTATATCATGTCAAGAGG 3') and ccSSr4 R2 (5' GAACGTTTT CTACTTCAAGACC 3'), developed by S. Volz. For recalcitrant DNAs, we reduced annealing temperatures to 48°C or used Phusion High-Fidelity polymerase (Finnzymes Oy, Espoo, Finland) or KOD Hot Start DNA polymerase (Novagen, Houston, Texas, USA) according to the manufacturers protocols. PCR products were purified with the Wizard SV Gel and PCR clean up system (Promega, Madison, Wisconsin, USA). Sequencing reactions used the same primers as PCR amplifications except for the psbA forward primer, which was replaced by psbA-5, 5' AYAACTTYCCTCTAGAYYTAGC 3' (developed by A. Kocyan, University of Munich).
Nuclear loci amplified were the internal transcribed spacer (ITS) of the ribosomal DNA and the second intron of the nuclear LFY gene (referred to herein simply as LFY). The ITS region, including 130 nucleotides of the 3' end of the 18S gene, the 5.8S gene, and 92 nucleotides of the 5' end of the 25S gene, was amplified using the primers of Balthazar et al. (2000)
. The LFY intron was amplified with the primers LFY CucF 5' TCTTCCACCTSTATGARCAGTGTCGTGAAT 3' and LFY CucR 5' CGAAATCACAAA AGYTATTGSGYAKTYCA 3' (developed by H. Schaefer, University of Munich). For both nuclear markers, we used cloning to assess within-plant sequence divergence. For cloning, we pooled three parallel PCR products, obtained with high-fidelity polymerase, and purified and ligated them into plasmids of the Promega pGEM-T Vector system (Promega). Plasmids were transformed in ultracompetent E. coli DH5alpha strains or JM109 competent cells (Promega). Positive (white) plasmid colonies were picked from the ampicillin blue/white selection agar plates, dissolved in H2O and directly amplified with primer oligonucleotides and settings as mentioned. PCR products were purified and sequenced using the same primers.
Sequencing relied on Big Dye Terminator kits (Applied Biosystems, Foster City, California, USA) and an ABI 3100 Avant capillary sequencer (Applied Biosystems). Sequence assembly and editing were carried out in the program Sequencher (version 4.6; Gene Codes, Ann Arbor, Michigan, USA). All sequences were BLAST-searched in GenBank.
Alignments and phylogenetic analyses
Sequences were aligned in MacClade version 4.08 (Maddison and Maddison, 2003
) and adjusted by eye. The chloroplast data matrix included sequences from both subspecies of Ecballium elaterium (three monoecious and four dioecious individuals were sequenced), plus an Austrobryonia as a more distant outgroups. We excluded the last seven nucleotides of a poly A run of up to 16 nucleotides in the psbA-trnH spacer, the last five of a poly A run of up to 14 nucleotides in the trnL intron, and the last 23 of a poly T run of up to 31 nucleotides again in the trnL intron. LFY alignments did not include outgroups because Ecballium and Austrobryonia sequences were too divergent to be aligned with those of Bryonia. We prepared two LFY matrices, one with all sequences and one that excluded identical sequences from the same individual. Indels in the chloroplast and LFY alignments were coded using simple gap coding (Simmons and Ochoterena, 2000
) as implemented in the SeqState software (Müller, 2005
), and parsimony searches were conducted with and without gap characters. Maximum likelihood (ML) and Bayesian searches included the coded gaps.
We used the programs Modeltest version 3.7 (Posada and Crandall, 1998
) and DTModSel (Minin et al., 2003
) to find best-fitting substitution models, applying both the Akaike and Bayesian information criteria. For the chloroplast (cp) data (with indels excluded), both softwares and criteria favored the K81uf + G model, while for the LFY data, Modeltest chose the HKY + G model and DTModSel the HKY + I model. We nevertheless had to rely on the slightly more parameter-rich GTR + G and GTR + G + I models because of limited model choice in the programs RAxML version 2.2.3 (Stamatakis, 2006
) and MrBayes version 3.1.2 (Ronquist and Huelsenbeck, 2003
). Bayesian searches involved four chains and two runs, using the default priors in MrBayes. Convergence of Bayesian analyses was assessed by checking that final likelihoods and majority rule topologies in different runs were similar, that the standard deviations (SDs) of split frequencies were <0.01, and that the convergence diagnostic (given by MrBayes) approached 1 and by examining the plot provided by MrBayes of the generation number vs. the log probability of the data. Likelihood searches were carried out according to the RAxML manual. Parsimony analyses in the program PAUP* version 4.0b10 (Swofford, 2002
) used heuristic searches with 10 random-taxon-addition replicates, holding 10 trees at each step, tree-bisection-reconnection (TBR) branch swapping, and the options MulTrees, Collapse zero-length branches, no Steepest Descent, and a limit of 100 trees held in memory.
Statistical support was measured by (1) ML bootstrapping with the same model and settings as used during tree searches, (2) posterior probabilities (PP) as obtained from MrBayes, and (3) nonparametric bootstrapping in PAUP*, using the fast bootstrap option and 1 million replicates.
Molecular clock analyses
Likelihood ratio tests of the Bryonia chloroplast data (including Ecballium and Austrobryonia) under the GTR + G model with and without the assumption of clock-like substitution accumulation rejected the strict clock model. We therefore used a relaxed clock model, specifically the Bayesian autocorrelated-rates approach implemented in the program multidivtime (Thorne and Kishino, 2002
). Prior gamma distributions on parameters of the clock model were as follows. The mean of the prior for the root age was set to 45.5 million years (Myr), based on the age of this node obtained in a strict clock analysis that used a Cucurbitaceae family-wide data set (described later); the SD of this prior was also set to 45. The mean (and SD) of the prior for the ingroup root rate were set to 0.0004 substitutions/site/Myr by dividing the median of the distances between the ingroup root and the tips by 45.5 Myr. The prior (and SD) for the Brownian motion parameter were set to 0.022, based on the manuals recommendation that the time between root and tips multiplied by this parameter should be about 1. As an internal constraint, we used the age of Bryonia-like seeds from the Middle Miocene fossil beds of Tambov, Western Siberia (Dorofeev, 1963
, Dorofeev, 1988
). The layer where the seeds were found is part of the Ternovskie stratum, which dates to the Lower Sarmat, 15–13 Myr ago (Nalivkin and Sokolov, 1986
). The seeds measure 1.8–2.3 x 2.5–4 mm, while extant Bryonia seeds typically measure 3–4 x 4–5 mm. Their oval, laterally flattened shape corresponds to most Bryonia seeds except those of B. verrucosa, which are larger and more oblong. On the basis of these fossils, we assigned a minimal age of 14 Myr to the split of B. verrucosa from the remaining species (this being the deepest split in the genus; see Results). Markov chains were run for 10 million generations, sampling every 100th generation for a total of 100 000 trees, with a burn-in of 10 000 trees before the first sampling of the Markov chain. The analysis was repeated twice from different random initial seed numbers to approximate posteriors and check for convergence.
In an alternative approach, we applied a strict clock model to an rbcL data set of 198 Cucurbitaceae, including Austrobryonia (all four species), Ecballium elaterium, B. alba, B. dioica, and B. verrucosa, plus Corynocarpaceae and Coriariaceae for rooting purposes. The rbcL branch lengths were optimized under the GTR + G + I + clock model on the maximum likelihood topology obtained for these 198 taxa with five combined chloroplast loci, including rbcL (sequences from Kocyan et al., 2007
; Schaefer et al., 2008
; this study). The resulting branch length table from PAUP* was saved, and a substitution rate calculated by dividing the genetic distance between a calibration node and the present by the age of the calibration node. The calibration node used was the crown group of Cucurbitaceae, which is about 60 Myr old, based on Trichosanthes-like seeds from the uppermost Paleocene (Collinson et al., 2003
). The resulting substitution rate was used to calculate the divergence ages of interest. Following Renner and Meyer (2001)
, we used binomial probability theory to estimate the SD of the distance from the fixed calibration node to the tips and then used this value to obtain the SDs of the estimated ages of interest.
Chromosome counts and experimental interspecies crosses
For chromosome counting, wild plants of Bryonia alba, B. aspera, B. cretica, B. dioica, B. monoica, B. syriaca, and B. verrucosa were brought into cultivation at the Botanical Garden Munich. No living material could be obtained of the North African B. acuta. Root tips were harvested, pretreated with 2 mM 8-hydroxyquinoline solution, fixed in 3:1 ethanol:acetic acid, and stored until use at –20°C. Chromosome spreads were obtained after hydrolysis in 0.5 N hydrochloric acid at 60°C for 10 min and staining with a saturated orcein-glacial acetic acid solution.
RESULTS
Phylogenetic and phylogeographic analyses of the chloroplast data
The sequenced individuals with species names and authors, collecting locality, place of voucher deposition, and GenBank accession numbers are listed in Appendix S1 (see Supplemental Data with online version of this article). Alignments and trees have been submitted to TreeBASE (http://www.treebase.org, submission name Stefanie M. Volz, PIN 25754). Because these chloroplast loci represent a single linkage group, the data were combined into a combined matrix of 1906 aligned characters, including 48 coded indels. This matrix comprised 135 sequences, 127 of Bryonia, seven of Ecballium, and one of Austrobryonia, and contained little homoplasy as indicated by a parsimony consistency index of 0.9. A maximum likelihood tree from these data strongly supports the monophyly of Bryonia (Fig. 1). Bryonia verrucosa from the Canary Islands is sister to all other species, and the remaining sequences fall into 10 clades that correspond to the morphological species recognized by Jeffrey (1969)
.
|
|
Nuclear phylogenies, differences between chloroplast and nuclear data, and sexual system evolution
Nuclear LFY sequences were obtained from 46 plants, selected to represent all cp haplotypes (Appendix S1, see online Supplemental Data). Extensive cloning resulted in 111 sequences. The alignment comprised 524 characters, including 51 coded indels. Cloned sequences from the same plant usually fell together, and exclusion of identical colonies and recombinant sequences left a data set of 54 sequences. A ML tree from these sequences is shown in Fig. 3. Sequences grouped by species except for those of B. cretica, B. dioica, and B. marmorata. Bryonia cretica sequences from different individuals as well as cloned sequences from the same individual appear in three places, namely near the base of the tree (plants SV03 and SV19), in the "center" of the tree (an allele from SV16), and near its top (other alleles of plants SV16 and SV19 plus sequences from plants SV15, SV20, SV30). Haplotypes of B. dioica form a polytomy with those of B. cretica, B. acuta, and B. marmorata (Fig. 3). Table 1 shows interallelic genetic distances among LFY alleles found in the different species. As expected from the tree, genetic distances among B. cretica alleles are by far the largest.
|
|
A ML tree from the nuclear ITS sequences (Appendix S2, see online Supplemental Data; 76 sequences from 14 plants representing all species; alignment length 883 characters, including 48 coded indels) yielded almost no resolution and showed much intermixing of sequences from different species, albeit without statistical support. Thirty-one of these sequences had
1 indels or substitutions in the 5.8S gene, the 3' region of the 18S gene, or the 5' region of the 25S gene and were therefore probably pseudogenes. Appendix S3 (see online Supplemental Data) gives their G/C contents, a measure of RNA-folding stability.
The distribution of monoecy and dioecy on the nuclear tree (Fig. 3) implies at least two transitions between these two systems, irrespective of whether the ancestral sexual system was dioecy or monoecy (see Discussion).
Chromosome numbers and sexual system
Table 2 lists chromosome counts for Bryonia and Ecballium. Most Bryonia species have 2n = 2x = 20, but B. cretica is hexaploid (2n = 6x = 60; two individuals counted), B. marmorata tetraploid (2n = 4x = 40; one individual counted), and B. aspera diploid or tetraploid (three individuals counted). Plotting of the chromosome numbers on the nuclear tree (Fig. 3) reveals no consistent relationship between polyploidy and sexual system; there are diploid and polyploid dioecious and monoecious species of Bryonia.
|
A relaxed clock model applied to combined intron and spacer sequences of Bryonia and Ecballium with the root (the split from Austrobryonia) constrained to maximally 45.5 Myr old (based on the result from the strict clock) and the split between B. verrucosa and the remaining species constrained to minimally 14 Myr old based on Bryonia fossil seeds (see Materials and Methods), yielded an age of 9.8 (95% CI 5.8–15.9) Myr for the most recent common ancestor of the remaining haplotypes of Bryonia (the node marked by an arrow in Fig. 1). Because the relaxed clock model was poorly constrained and species relationships are not solidly resolved by the cp data, we refrained from estimating node ages higher up in the tree.
As an alternative means to gain a sense of the absolute age of Bryonia, we examined silent and nonsilent substitutions in the conservative rbcL gene. The three species sequenced for rbcL (B. alba, B. dioica, and B. verrucosa) when compared to 195 other Cucurbitaceae sequences share two synapomorphic silent substitutions (CTA instead of TTA at position 270 and TTA instead of TTG at position 280; numbered according to spinach rbcL for which protein crystal structure is available (Knight et al., 1990
)). Bryonia alba furthermore differs in two silent substitutions from the other two (CCC instead of CCT at position 168 and CTG instead of CTT at position 335), and B. verrucosa differs in three nonsilent substitutions from B. alba and B. dioica (TAT (tyrosine) instead of TTT (phenylalanine) at position 226; TCT (serine) instead of GCT (alanine) at position 281; TCT (serine) instead of GCT (alanine) at position 328).
DISCUSSION
This study set out to infer sexual system evolution in Bryonia and to look for possible associations between hybridization, polyploidy, and sexual system. Of particular interest were the relationships among B. alba, B. dioica, and B. aspera, the monoecious and dioecious species of Bryonia used in the classic experiments that led to the inference of monofactorial dominant inheritance of dioecy in Bryonia and of the presence of XY sex determination in B. dioica (Correns, 1903
, Correns, 1907
; Bateson, 1909
; Heilbronn and Basarman, 1942
; Heilbronn, 1953
; Westergaard, 1958
). We discuss these aspects in turn, bringing in the geographic and temporal context as relevant.
Evolutionary transitions between monoecy and dioecy in Bryonia
Given the unresolved backbones of the nuclear and plastid gene phylogenies (Figs. 1 and 3) and considering that the closest relative of Bryonia is a single species with a monoecious and a dioecious subspecies, the ancestral sexual system of Bryonia cannot be inferred with confidence. If the common ancestor of Bryonia was dioecious, this would imply two transitions to monoecy, one in the common ancestor of B. alba and B. aspera, and one in the ancestor of B. monoica. The alternative scenario of ancestral monoecy may require four character transitions, viz. evolution of dioecy in B. verrucosa, in B. syriaca, in B. multiflora, and in the common ancestor of the B. dioica polytomy (B. acuta, B. cretica, B. dioica, and B. marmorata). The picture is complicated by B. cretica sequences appearing in three places in the nuclear tree (Fig. 3) and in two places in the chloroplast tree (Fig. 1). A further complication is that the monoecious species B. alba and B. monoica may occasionally be dioecious, although this has only been inferred from herbarium specimens (Jeffrey, 1969
; see Materials and Methods). The family Cucurbitaceae in general is well known for changes between dioecy and monoecy at the genus, species, and population level (Roy and Saran, 1990
; Zhang et al., 2006
; Renner et al., 2007
).
Although the ancestral sexual system of Bryonia is not securely known, there is unequivocal evidence for minimally two transitions in sexual systems, implying that the evolution of XY sex determination, i.e., the suppression of recombination between a pair of chromosomes carrying sex-determining genes, probably was dynamic. This fits with the phylogeny of a male-linked locus obtained from a broad sample of B. dioica (from Sweden to North Africa; R. Oyama, S. Volz, and S. Renner, unpublished manuscript). All northern sequences are clearly male or female, while in some southern populations the Y chromosome appears to undergo occasional recombination.
The species involved in the early genetic experiments, B. alba and B. dioica (Correns; 1903
, 1907
; Bateson, 1909
), and B. aspera and B. dioica (Heilbronn, 1953
, Heilbronn and Basarman, 1942
; Bilge, 1955
), are not particularly close to each other. Judged from the molecular clock estimates and the distinctly different rbcL sequences of B. alba and B. dioica (compared to almost 200 other Cucurbitaceae sequences), they are separated by several million years of evolution. Based on a strict clock, the deepest split in Bryonia dates back 8.4 ± 1.8 Myr. Such a long history of Bryonia in Eurasia fits with the existence of an oligolectic Bryonia-specialist, the halictid bee Andrena florea whose range overlaps that of Bryonia (Westrich, 1989
; Schröder and Lunau, 2001
) except on the Canary Islands, and which is roughly as old as Bryonia based on a molecular clock (L. Larkin, University of New Mexico, Albuquerque, personal communication).
Hybridization and polyploidy in the evolution of Bryonia
The only contradictions between the nuclear and chloroplast topologies involve B. multiflora and B. cretica. Our sampling of B. cretica is confined to the western part of its range, namely, the islands Kythera and Crete, and the Peloponnesian Peninsula (Appendix S1, see online Supplemental Data). On Kythera, B. cretica shows clear evidence of a hybrid origin, with individuals from the same location having the M or the C cp haplotype. The M haplotype points to B. dioica as one of the progenitors of B. cretica because this haplotype is common in B. dioica populations from France, Spain, Algeria, and Morocco (Fig. 2; the M haplotype otherwise only occurs in B. marmorata, a species endemic to Corsica and Sardinia). This hypothesis receives support from the nuclear tree (Fig. 3) in which some B. cretica and B. dioica alleles group together. The ranges of B. cretica and B. dioica come closest in southern Italy (Fig. 2), but our sampling there is insufficient to resolve the fine-scale distribution of the M haplotype. It may be relevant in this context that Jeffrey (1969
, p. 447) found "distinct" specimens of B. dioica in southern Italy and Sicily that resemble B. cretica in their coarsely punctate leaves, but differ from that species in having glandular-pubescent inflorescences. Other parents of B. cretica may have been B. multiflora and/or B. syriaca, either of which could have contributed the C haplotype to B. cretica. The ranges of both partly overlap that of B. cretica (Fig. 2). Where Bryonia individuals are in flower at the same time, they automatically share at least one pollinator, namely, the aforementioned oligolectic sand bee Andrena florea, which has a foraging range of up to 1 km (Edwards and Williams, 2004
).
Fitting with its inferred hybrid origin, B. cretica has several morphological variants, a typical one from southern Greece, Crete, and the Aegean Islands (which is the one sampled; the plant described by Linnaeus as B. cretica came from Crete) and another that occurs in Cyprus, Syria, Turkey, and Palestine (Jeffrey, 1969
, p. 448). The latter variant is similar to B. multiflora, one of the suspected progenitors (discussed previously). A further indication of past hybridizations among some species of Bryonia may be the substitutions found in the 5.8S gene (Appendix S3, see online Supplemental Data), which indicate coexisting pseudogenic copies, perhaps due to inactived 35S rDNA loci (H. Weiss-Schneeweiss, University of Vienna, personal communication).
The other polyploid species of Bryonia, the tetraploid B. marmorata, is endemic to Corsica and Sardinia. Cloning and direct sequencing yielded a single chloroplast haplotype and quite homogeneous LFY alleles (Table 1). This suggests that B. marmorata may have originated via autopolyploidy, perhaps from an individual of B. dioica, a species with which B. marmorata shares the M haplotype and to which its LFY alleles are related (Figs. 2 and 3). However, only two individuals of B. marmorata were sequenced (and only one counted for chromosomes), and more data are needed to firmly infer autopolyploidy.
Associations between polyploidy and sexual systems
Polyploidization can lead to a breakdown of some forms of nuclear-determined dioecy (Westergaard, 1958
; Smith, 1955
, Smith, 1969
). In Bryonia, however, this does not seem to be the case; the hexaploid B. cretica and the tetraploid B. marmorata are both dioecious. In Mercurialis, with an unknown sex determination mechanism, a loose negative association between polyploidy and dioecy may result from a combination of homoploid speciation, genome duplication, and hybridization, with the precise sequence of events unclear (Durand and Durand, 1992
; Obbard et al., 2006
). As is likely the case in Bryonia, monoecy in Mercurialis sometimes evolved from dioecy (Obbard et al., 2006
). However, the life histories of Bryonia and Mercurialis are so different that fruitful comparison is difficult; all Bryonia are climbers that annually sprout from large long-lived underground tubers; species of Mercurialis are annuals or woody perennials. The hypothesis that polyploidy may favor dioecy as an outcrossing mechanism because polyploid species may experience a breakdown of their self-incompatibility system (Miller and Venable, 2000
; Yeung et al., 2005
) is unlikely to apply to Bryonia, which is capable of selfing (S. Volz, personal observation).
Different from what we expected, hybridization appears to play a minor role in Bryonia, which turned out to be a relatively old clade of genetically (mostly) distinct entities. The genetic distinctness of most species was unexpected from the morphological situation, where species can be difficult to distinguish (Jeffrey, 1969
). It was also surprising to find (minimally) two shifts in sexual system in a genus of just 10 species. Together, these results provide a basis for developing Bryonia into a model system for the study of plant sex chromosome evolution, which so far has focused exclusively on species with heteromorphic sex chromosomes.
FOOTNOTES
1 The authors thank O. Tal and H. S. Paris for tubers and seeds of B. syriaca; the colleagues listed in online supplemental Appendix S1 for leaf material; D. Egamberdiyeva for hospitality in Uzbekistan; M. Pingen for information on fossil seeds; E. Vosyka for help with chromosome counts; S. Raidl for help with stomata measurements; G. Brokamp for the map; and R. Oyama, H. Schaefer, C. Jeffrey, and an anonymous reviewer for comments on earlier versions of this manuscript. Supported by DFG RE603/4-1. ![]()
2 Author for correspondence (e-mail: renner{at}lrz.uni-muenchen.de) ![]()
LITERATURE CITED
Albers, F., AND W. Pröbsting. 1998. Chromosomenatlas der Farn- und Blütenpflanzen Deutschlands. In R. Wisskirchen, and H. Haeupler [eds.], Standardliste der Farn- und Blütenpflanzen Deutschlands, 562–616. Bundesamt für Naturschutz und Eugen Ulmer, Stuttgart, Germany.
Aryavand, A. 1980. IOPB chromosome number reports LXIX. Taxon 29: 704.
Balthazar, M. von, P. K. Endress, AND Y. Qiu. 2000. Phylogenetic relationships in Buxaceae based on nuclear internal transcribed spacers and plastid ndhF sequences. International Journal of Plant Sciences 161: 785–792.[CrossRef][Web of Science]
Bateson, W. 1909. Mendels principles of heredity. Cambridge University Press, Cambridge, UK.
Bilge, E. 1955. Recherches morphologiques, anatomiques et génétiques sur Bryonia macrostylis. Revue de la Faculté des Science de LUniversité dIstanbul, série B 20: 121–146.
Brabec, F., AND J. Pohlmann. 1969. Untersuchungen zur Bestimmung der Karyotypen von B. alba, B. dioica und B. verrucosa. Biologisches Zentralblatt 88: 715–730.
Castroviejo, S. 1993. Flora Iberica, vol. III, 456–458. Real Jardín Botánico, Consejo Superior de Investigaciones Científicas, Madrid, Spain.
Chiappini, M. 1985. Bryonia marmorata Petit. Guida alla flora practica della Sardegna. Carlo Delfino, Sassari, Italy.
Chung, S. M., D. S. Decker-Walters, AND J. E. Staub. 2003. Genetic relationships within the Cucurbitaceae as assessed by consensus chloroplast simple sequence repeats (ccSSR) marker and sequence analyses. Canadian Journal of Botany 81: 814–832.[CrossRef]
Collinson, M. E., J. J. Hooker, AND D. R. Grocke. 2003. Cobham lignite bed and penecontemporaneous macrofloras of southern England: A record of vegetation and fire across the Paleocene–Eocene thermal maximum. In S. L. Wing, P. D. Gingerich, B. Schnitz, and E. Thomas [eds.] Causes and consequences of globally warm climates in the Early Paleogene, 333–350. Geological Society of America Special Paper 369. Geological Society of America, Boulder, Colorado, USA.
Contandriopoulos, J., D. Noguet, AND C. Zevaco-Schmitz. 1987. Contribution à létude de quelques espèces intéressantes de Corse: Cytotaxonomie et comportement écologique. Revue de Biologie-Ecologie. Méditerranéenne 10: 259–271.
Correns, C. 1903. Über die dominierenden Merkmale der Bastarde. Berichte der Deutschen Botanischen Gesellschaft 21: 133–147.
Correns, C. 1907. Die Bestimmung und Vererbung des Geschlechtes, nach Versuchen mit höheren Pflanzen. Verhandlungen der Gesellschaft deutscher Naturforscher und Ärzte 1907: 794–802.
Costich, D. E. 1995. Gender specialization across a climatic gradient: Experimental comparison of monoecious and dioecious Ecballium. Ecology 76: 1036–1050.[CrossRef][Web of Science]
Costich, D. E., AND F. Galán. 1988. The ecology of the monoecious and dioecious subspecies of Ecballium elaterium (L.) A. Rich. (Cucurbitaceae). I. Geographic distribution and its relationship to climatic conditions in Spain. Lagascalia 15 (Supplement): 697–710.
Costich, D. E., AND T. R. Meagher. 1992. Genetic variation in Ecballium elaterium: Breeding system and geographic distribution. Journal of Evolutionary Biology 5: 589–601.[CrossRef][Web of Science]
Dempsey, R. E., R. J. Gornall, AND J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
Dobes, C., B. Hahn, AND W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biologische Beiträge 29: 5–43.
Dorofeev, P. I. 1963. The Tertiary floras of western Siberia, 271. Izdvo Akademii Nauk SSSR, Moscow-Leningrad, USSR.
Dorofeev, P. I. 1988. Miozäne Floren des Bezirks Tambov. Akademija Nauka SSSR, Leningrad, USSR.
Durand, R., AND B. Durand. 1992. Dioécie, monoécie, polyploidie et speciation chez les Mercuriales annuelles. Bulletin Société de botanique de France 139, Lettres botanique 4/5: 377–390.
Edwards, M., AND P. Williams. 2004. Where have all the bumblebees gone and could they ever return? British Wildlife 2004: 1–11.
Feinbrun, N. 1978. Bryonia. Flora Palaestina III: 273–274.
Galán, F. 1946. Sur la génetique de la monoecie et la dioecie zygotique chez Ecballium elaterium Rich. Comptes Rendus des Séances de lAcadémie des Sciences, Paris 222: 1130–1131.
Hasitschka-Jenschke, G. 1961. Das Längenverhältnis der eu- und heterochromatischen Abschnitte riesenchromosomenartiger Bildungen verglichen mit dem der Prophase-Chromosomen bei Bryonia dioica. Chromosoma 12: 466–483.[CrossRef][Medline]
Heilbronn, A. 1953. Ueber die Rolle des Plasmas bei der Geschlechtsbestimmung der Bryonien. Revue de la Faculté des Science de lUniversité dIstanbul, série B 18: 205–207.
Heilbronn, A., AND M. Basarman. 1942. Ueber die F2 der Bryonia Bastarde und ihre Bedeutung für das Problem der Geschlechtsrealisation. Revue de la Faculté des Science de lUniversité dIstanbul, série B 7: 138–144.
Heilbronn, A., AND E. Bilge. 1954. Über eine neue Bryonia aus Ostanatolien. Revue de la Faculté des Science de lUniversité dIstanbul, série B 19: 79–81, 1 plate.
Holmgren, P. K., N. H. Holmgren, AND L. C. Barnett. 1990. Index Herbariorum 1: The herbaria of the world. New York Botanical Garden, Bronx, New York, USA.
Javurkova, V. 1981. Chromosome number reports LXXIII. Taxon 30: 856–857.
Jeffrey, C. 1969. A review of the genus Bryonia L. (Cucurbitaceae). Kew Bulletin 23: 441–461.[CrossRef]
Knight, S., I. Andersson, AND C. I. Branden. 1990. Crystallographic analysis of ribulose1,5-bisphosphate carboxylase from spinach at 2.4 Å resolution. Journal of Molecular Biology 215: 113–160.[CrossRef][Web of Science][Medline]
Kocyan, A., L.-B. Zhang, H. Schaefer, AND S. S. Renner. 2007. A multi-locus chloroplast phylogeny for the Cucurbitaceae and its implications for character evolution and classification. Molecular Phylogenetics and Evolution 44: 553–577.[CrossRef][Web of Science][Medline]
Lindsay, R. H. 1930. The chromosomes of some dioecious angiosperms. American Journal of Botany 17: 152–174.[CrossRef][Web of Science]
Maddison, D. R., AND W. P. Maddison. 2003. MacClade 4: Analysis of phylogeny and character evolution, version 4.08. Sinauer, Sunderland, Massachusetts USA.
Magulaev, A., AND N. Vu. 1984. Cytotaxonomic study in some flowering plants of the North Caucasus. Botaniceskjij Zurnal SSSR 69: 511–517.
Meurman, O. 1925. The chromosome behavior of some dioecious plants and their relatives with special references to sex chromosomes. Societas Scientiarum Fennica, Commentationes Biologicae 2: 1–105.
Miller, J. S., AND D. L. Venable. 2000. Polyploidy and the evolution of gender dimorphism in plants. Science 289: 2335–2338.
Minin, V., Z. Abdo, P. Joyce, AND J. Sullivan. 2003. Performance-based selection of likelihood models for phylogeny estimation. Systematic Biology 52: 674–683.
Montmollin, B. de 1986. Étude cytotaxonomique de la flore de la Crète. III. Nombres chromosomiques. Candollea 41: 431–439.
Müller, K. 2005. SeqState—Primer design and sequence statistics for phylogenetic DNA data sets. Applied Bioinformatics: 65–69.
Nalivkin, D. V., and B. S. Sokolov [eds.]. 1986. Stratigrafiya SSSR. Neogenovaya Sistema 2. Nauka Publishing, Moscow, USSR.
Nazarova, E. 1997. Mediterranean chromosome number reports 7. Flora Mediterranea 7: 213–218.
Obbard, D. J., S. A. Harris, R. J. A. Buggs, AND J. R. Pannell. 2006. Hybridization, polyploidy, and the evolution of sexual systems in Mercurialis (Euphorbiaceae). Evolution 60: 1801–1815.[Web of Science][Medline]
Pannell, J. R., M. E. Dorken, B. Pujol, AND R. Berjano. 2008. Gender variation and transitions between sexual systems in Mercurialis annua (Euphorbiaceae). International Journal of Plant Sciences 169: 129–139.[CrossRef][Web of Science]
Pannell, J. R., D. J. Obbard, AND R. J. A. Buggs. 2004. Polyploidy and the sexual system: What can we learn from Mercurialis annua. Biological Journal of the Linnean Society 82: 547–560.[CrossRef][Web of Science]
Pogan, E., A. Jankun, AND H. Wcislo. 1990. Further studies in chromosome numbers of Polish angiosperms. Part XXIII. Acta Biologica Cracoviensia, series: Botanica 32: 179.
Posada, D., AND K. A. Crandall. 1998. Modeltest: Testing the model of DNA substitution. Bioinformatics (Oxford, England) 14: 817–818.[CrossRef]
Renner, S. S., AND K. Meyer. 2001. Melastomeae come full circle: Biogeographic reconstruction and molecular clock dating. Evolution 55: 1315–1324.[Web of Science][Medline]
Renner, S. S., H. Schaefer, AND A. Kocyan. 2007. Phylogenetics of Cucumis (Cucurbitaceae): Cucumber (C. sativus) belongs in an Asian/Australian clade far from melon (C. melo). BMC Evolutionary Biology 7: 58.[CrossRef][Medline]
Rheinberger, H.-J. 2000. Mendelian inheritance in Germany between 1900 and 1910. The case of Carl Correns (1864–1933). Comptes Rendus de lAcadémie des Sciences, Sciences de la Vie 323: 1089–1096.[CrossRef]
Rieseberg, L. H., AND J. Wendel. 1993. Introgression and its consequences in plants. In R. Harrison [eds.], Hybrid zones and the evolutionary process, 70–109. Oxford University Press, New York, New York, USA.
Ronquist, F., AND J. P. Huelsenbeck. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics (Oxford, England) 19: 1572–1574.[CrossRef]
Rottenberg, A. 2000. Fertility of exceptional bisexual individuals in four dioecious plant species. Sexual Plant Reproduction 12: 219–221.[CrossRef][Web of Science]
Roy, R. P., AND S. Saran. 1990. Sex expression in the Cucurbitaceae. In D. M. Bates, W. Robinson, and C. Jeffrey [eds.], Biology and utilization of the Cucurbitaceae, 251–268. Comstock Publishing Associates, Cornell University Press, Ithaca, New York.
Rubino, D. B., AND T. C. Wehner. 1986. Effect of inbreeding on horticultural performance of lines developed from an open-pollinated pickling cucumber population. Euphytica 35: 459–464.[CrossRef][Web of Science]
Sang, T. D., J. Crawford, AND T. F. Stuessy. 1997. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84: 1120–1136.[Abstract]
Schaefer, H., I. R. H. Telford, AND S. S. Renner. 2008. Austrobryonia (Cucurbitaceae), a new Australian endemic genus, is the closest living relative to the Eurasian and Mediterranean Bryonia and Ecballium. Systematic Botany 33: 125–132.[CrossRef][Web of Science]
Schröder, S., AND K. Lunau. 2001. Die oligolektische Sandbiene Andrena florea und die Rote Zaunrübe Bryonia dioica—Schnittstelle zweier spezialisierter Fortpflanzungssysteme. Mitteilungen der Deutschen Gesellschaft fur Allgemeine und Angewandte Entomologie 13: 529–533.
Simmons, M. P., AND H. Ochoterena. 2000. Gaps as characters in sequence-based phylogenetic analyses. Systematic Biology 49: 369–381.
Slavick, B., V. Jarolimovac, AND J. Chrtek. 1993. Chromosome counts of some plants from Cyprus. Candollea 48: 221–230.
Smith, B. W. 1955. Sex chromosomes and natural polyploidy in dioecious Rumex. Journal of Heredity 46: 226–232.
Smith, B. W. 1969. Evolution of sex-determining mechanisms in Rumex. Chromosomes Today 2: 172–182.
Sopova, M., Z. Sekovski, AND M. Jovanovska. 1983. Chromosome atlas of some Macedonian angiosperms. IV. Godisen Sbornik Biologija 36: 73–86.
Stamatakis, A. 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics (Oxford, England) 22: 2688–2690.[CrossRef]
Strasburger, E. 1910. Über geschlechtsbestimmende Ursachen. Jahrbücher für Wissenschaftliche Botanik 48: 427–520.
Swofford, D. L. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods), version 4.0b10. Sinauer, Sunderland, Massachusetts, USA.
Taberlet, P., L. Gielly, G. Pautou, AND J. Bouvet. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105–1109.[CrossRef][Web of Science][Medline]
Thorne, J. L., AND H. Kishino. 2002. Divergence time and evolutionary rate estimation with multilocus data. Systematic Biology 51: 689–702.
Tischler, G. 1950. Die Chromosomenzahlen der Gefäßpflanzen Mitteleuropas. W. Junk, Gravenhage, Netherlands.
Turaetla-Szybowska, K. 1990. Further studies in chromosome numbers of Polish angiosperms, part 23. Acta Biologica Cracoviensia. series: Botanica 32: 172, 179–180.
Van Den Brand, C., F. C. M. Van Meel, AND J. H. Wieffering. 1979. IOPB chromosome number reports LXIV. Taxon 28: 395–397.
Vassilczenko [Vasilchenko], I. T. 1957 [1972, English version]. Genus 1422. BryoniaL. Flora of the U.S.S.R., vol. 24, 74–80.
Volz, S. M., AND S. S. Renner. In press. Phylogeography of the ancient Eurasian medicinal plant genus Bryonia (Cucurbitaceae) inferred from nuclear and chloroplast sequences. Taxon.
Westergaard, M. 1958. The mechanism of sex determination in dioecious flowering plants. Advances in Genetics 9: 217–281.[Web of Science][Medline]
Westrich, P. 1989. Die Wildbienen Baden-Wuerttembergs, vols. 1 and 2. Eugen Ulmer, Stuttgart, Germany.
Whitaker, T. W. 1933. Cytological and phylogenetic studies in the Cucurbitaceae. Botanical Gazette (Chicago, Ill.) 94: 780–790.[CrossRef]
Yeung, K., J. S. Miller, A. E. Savage, B. C. Husband, B. Igic, AND J. R. Kohn. 2005. Association of ploidy and sexual system in Lycium californicum (Solanaceae). Evolution 59: 2048–2055.[Web of Science][Medline]
Zhang, L.-B., M. P. Simmons, A. Kocyan, AND S. S. Renner. 2006. Phylogeny of the Cucurbitales based on DNA sequences of nine loci from three genomes: Implications for morphological and sexual system evolution. Molecular Phylogenetics and Evolution 39: 305–322.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Facebook
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
H. Schaefer, C. Heibl, and S. S Renner Gourds afloat: a dated phylogeny reveals an Asian origin of the gourd family (Cucurbitaceae) and numerous oversea dispersal events Proc R Soc B, March 7, 2009; 276(1658): 843 - 851. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |