Am. J. Bot. Subscribe to E-TOCs
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blanca, J. M.
Right arrow Articles by Nuez, F.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Blanca, J. M.
Right arrow Articles by Nuez, F.
Agricola
Right arrow Articles by Blanca, J. M.
Right arrow Articles by Nuez, F.
(American Journal of Botany. 2007;94:1219-1229.)
© 2007 Botanical Society of America, Inc.


Systematics and Phytogeography

AFLP and DNA sequence variation in an Andean domesticate, pepino (Solanum muricatum, Solanaceae): implications for evolution and domestication1

José M. Blanca, Jaime Prohens4, Gregory J. Anderson, Elena Zuriaga, Joaquín Cañizares and Fernando Nuez

Instituto para la Conservación y Mejora de la Agrodiversidad Valenciana, Universidad Politécnica de Valencia, Camino de Vera 14, 46022 Valencia, Spain; Department of Ecology and Evolutionary Biology, University of Connecticut, 75 North Eagleville Road, Storrs, Connecticut 06269 USA

Received for publication June 12, 2006. Accepted for publication May 14, 2007.

ABSTRACT

The pepino (Solanum muricatum) is a vegetatively propagated, domesticated native of the Andes, where it grows with wild relatives. We used AFLPs and a 1-kb sequence of the 3-methylcrotonyl-CoA carboxylase gene to study variation of 27 accessions of S. muricatum and 35 collections of 10 species of wild relatives (Solanum section Basarthrum). A total of 298 AFLP fragments and 29 DNA sequence haplotypes were detected. Cluster and principal coordinate analyses and other genetic parameters estimated from both types of markers, show that S. muricatum is closely related to the species from one of the series (Caripensia) of section Basarthrum and that >90% of the variation of the cultigen is also represented in that series. Pepino is highly diverse, either because it is not monophyletic or it has been subjected to regular introgression with wild species, or both. Although a continuous distribution of the genetic variation occurred within the cultivated species, three genetic clusters were recognized. Cluster 1 is mostly centered in Ecuador, cluster 2 in Ecuador and Peru, and cluster 3 in Colombia and Ecuador. Cluster 3 also includes all modern cultivars studied. These results and other evidence suggest that northern Ecuador/southern Colombia is the main center of pepino diversity and the center of origin. The high genetic variation of this cultigen indicates that domestication does not always produce a genetic bottleneck.

Key Words: AFLP • Andean region • crop evolution • DNA sequence • pepino • Solanum muricatumSolanum section Basarthrum

The pepino (Solanum muricatum Aiton) is an herbaceous Andean domesticate grown for its juicy and aromatic fruits. Although it was a very important crop in the Andean region in pre-Columbian times (Prohens et al., 1996 ), its 20th century prominence has not equaled that of its close relatives the tomato (Solanum lycopersicum L.) and potato (Solanum tuberosum L.). However, in the last three decades, there has been growing interest in the pepino from exotic fruit markets, and its cultivation has spread from its ancestral home in the Andes of South America to other countries such as New Zealand, Spain, and the Netherlands (Nuez and Ruiz, 1996 ).

The study of the molecular variation of the pepino is of interest for several reasons. Although the seeds of pepino plants are fertile and produce vigorous offspring, this crop is primarily propagated vegetatively by cuttings (Heiser, 1964 ; Anderson, 1979 ; Morley-Bunker, 1983 ), and as a consequence, its genetic structure could be different from that of seed-propagated crops. Also, the pepino is fairly easy to intercross with several wild species, and the cultigen is grown in the areas of natural distribution of some of the wild species (Heiser, 1964 ; Anderson, 1975 , 1977 ); therefore, natural hybridization and introgression with the closely related wild species is likely (e.g., Anderson et al., 1996 ). Pepino materials grown in Andean South America correspond to local landraces that have not been subjected to modern breeding (Nuez and Ruiz, 1996 ), but there are also many cultivars that have been developed elsewhere (e.g., Dawes and Pringle, 1983 ; Prohens et al., 2002 ). Because of this, the pepino is an interesting model for the study of (a) the intraspecific variation structure and (b) relationships with wild relatives, in a vegetatively propagated crop with a wide "natural" distribution where the crop still grows in close proximity to its closest wild relatives. Studying intraspecific variation and relationships with wild relatives will provide information for understanding the evolution and domestication of the pepino specifically and of the process of domestication generally.

Previous studies of the molecular variation of pepino have included analyses of patterns of flavonoids (Anderson et al., 1987 ) and cp-DNA restriction fragment length polymorphisms (RFLPs) (Spooner et al., 1993 ; Anderson et al., 1996 ; Anderson and Jansen, 1998 ). These first molecular studies determined that the wild species most closely related to the pepino were those of the series Caripensia (S. basendopogon Bitter, S. caripense Humb. and Bonpl. ex Dun., S. cochoae G. J. Anderson and Bernardello, S. filiforme Ruiz López and Pavón, S. fraxinifolium Dunal in DC, S. heiseri G. J. Anderson, and S. tabanoense Correll) and that intraspecific diversity existed. However, the molecular variation assessed with these markers was limited by the amount of the genome covered and was not appropriate for a detailed study of intraspecific variation of the cultigen, S. muricatum.

Polymorphisms in the DNA sequence of an individual gene can provide information on the evolutionary history of a species (Kimura, 1983 ), and they have been used to study domestication in cultivated plants (Schaal and Olsen, 2000 ; Olsen and Purugganan, 2002 ; Clark et al., 2004 ). These data, however, provide information on only a limited portion of the genome; therefore, multivariate techniques applied to sets of multilocus markers, such as the amplified fragment length polymorphisms (AFLP; Vos et al., 1995), may be more useful in identifying groups of genetically similar individuals. AFLPs show a high level of polymorphism in Solanaceae (Kardolus et al., 1998 ; Nuez et al., 2004 ; Spooner et al., 2006 ), and their use allows a large number of loci to be scored in a single reaction with much better repeatability among laboratories than other markers such as random amplified polymorphisms of DNA (RAPDs) (Jones et al., 1997 ). Furthermore, AFLPs have proved to be of great interest for the study of domestication processes in potato (Spooner et al., 2006 ), a crop closely related to pepino. Other types of markers that could be useful in such studies, such as simple sequence repeats (SSRs), are not available in the pepino. In this work, we use an approach that combines the variation in AFLPs and in the sequence of a nuclear gene to study the genetic relationships of the cultivated pepino to its closely related wild species, as well as the structure of its genetic variation over its natural range, i.e., that associated with its presumed region of origin and pre-Columbian cultivation in Colombia, Ecuador, and Peru (Heiser, 1964 ; Anderson, 1975 ; Anderson et al., 1996 ; Prohens et al., 1996 ). Because two complementary molecular techniques are used, results obtained are more robust than those based on a single technique. Although our study focuses on pepino, our data are relevant to a general understanding of evolution and domestication of crops.

MATERIALS AND METHODS

Plant materials
Materials studied included 22 accessions of Solanum muricatum that we have classified as the typical cultivated S. muricatum (our S. muricatum sensu stricto). In addition, there were five accessions that we consider to be putative introgressant forms, or natural hybrids between S. muricatum and wild species of the series Caripensia: we have called these S. muricatum sensu lato (Table 1).


View this table:
[in this window]
[in a new window]

 
Table 1. Solanum muricatum collections studied

 
To assess the relationships of the pepino with its wild relatives, we included 35 accessions representing the 12 closely related species from Solanum section Basarthrum (Table 2). The number of accessions included for each of the wild species depended on abundance (e.g., one accession for rare species) and availability of seeds. Among these materials there is an interspecific hybrid (S. tabanoense x S. caripense) as well as an odd accession of S. caripense (PI-243342) that, based on morphological characteristics, seems to have been introgressed with genes from S. muricatum (presumably during its repeated propagation in a seed bank). These accessions were also part of a separate AFLP study on the systematics of wild Basarthrum species (Prohens et al., 2006 ). Included among the wild species in the latter study were two newly described species (S. catilliflorum G. J. Anderson, Martine, Prohens and Nuez and S. perlongistylum G. J. Anderson, Martine, Prohens and Nuez) (Anderson et al., 2006 ).


View this table:
[in this window]
[in a new window]

 
Table 2. Wild Solanum section Basarthrum collections studied

 
To understand the distribution of genetic variation, we compared genetic clusters (derived from the AFLP analyses described in the "Results" section, subsection Structure of variation in the cultigen). This approach has been successfully applied to studies of other domesticates (Harter et al., 2004 ; Song et al., 2006 ).

Generation of molecular data
For each accession, genomic DNA was extracted from one plant using the DNeasy Plant Mini Kit (Qiagen, Valencia, California, USA) following the protocol of the manufacturer. The AFLP analyses (Vos et al., 1995) were carried out as described elsewhere (Nuez et al., 2004 ), using three selective combinations of primers (EcoNed: AGACTGCGTACCAATTCACC-Mse: GATGAGTCCTGAGTAAcac, EcoFam: AGACTGCGTACCAATTCCTT-Mse: GATGAGTCCTGAGTAACTT, EcoHex: AGACTGCGTACCAATTCCTC-Mse GATGAGTCCTGAGTAA). DNA fragments were separated in an ABI Prism 310 genetic analyzer (Applied Biosystems, Foster City, California, USA).

A preliminary survey carried out by sequencing six nuclear regions (CD15, CT81, CT165, CT267, CD23, CT137) from the tomato map (Tanksley et al., 1992 ) on several accessions of pepino and five other species of the closely related Solanum section Lycopersicon subsection Lycopersicon (i.e., S. chilense, S. habrochaites S. lycopersicum, S. peruvianum and S. pimpinellifolium) (Spooner et al., 2005 ) showed that the most variable region was CT137, which corresponds to a 3-methylcrotonyl-CoA carboxylase gene (MCC) (McKean et al., 2000 ). Therefore, this gene was chosen for further analysis in our materials.

The PCR amplification of the MCC gene was done with primers 006d (GTCCAAATCTGAGGCAAGTGG) and 006r (GGTAGCAGAGATGCAAAGGCTC). After amplification, the PCR products were treated with Exonuclease I and precipitated with NaCl and ethanol. DNA sequencing was performed using an ABI Prism 3100 genetic analyzer following manufacturer instructions for the BigDye terminator v3.1 cycle sequencing kit (Applied Biosystems). Four sequencing reactions were carried out to obtain a high-quality sequence of each PCR product. Apart from the primers 006d and 006r, internal primers 006d2 (GCTAAAGTTGTAGAGGCGTATGAC) and 006r2 (AAAAGCAGCCACGGAACCACA) were used for amplification.

Because all species analyzed are diploid (Bernardello and Anderson, 1990 ; Anderson et al., 2006 ) and we did not find any evidence of more than two haplotypes per individual, we assumed that the materials studied have a single copy of the MCC gene. Consequently, we considered the individuals as homozygous or heterozygous depending on whether one or two haplotypes, respectively, were found. Heterozygotes were detected as double peaks in the chromatogram. In most cases, both haplotypes were inferred through haplotype subtraction (Clark, 1990 ). In the cases with deletions in heterozygosis or with poor chromatogram quality, PCR products were cloned using the pGEM-T vector System II (Promega, Madison, Wisconsin, USA), and each haplotype was sequenced separately.

AFLP data analysis
The AFLP fragments were scored as binary traits (1 = present, 0 = absent) using Genographer 1.6 software (Benham et al., 1999 ). Because AFLPs are dominant and anonymous markers, phenetic methods are appropriate (Koopman et al., 2001 ). Principal coordinate analyses (PCoA) based on Dice distance matrices were performed using the NTsys 2.02g software package (Rohlf, 1996 ). Nei distances (Nei and Li, 1979 ) were calculated for 1000 bootstrapped data matrices using Phyltools 1.32 software (Buntjer, 1997 ), and a neighbor-joining phenogram was built with the Phylip 3.62 package (Felsenstein, 1989 ). Based on this analysis, the genetic clusters were defined. Genetic diversity (h) (Nei, 1973 ) was estimated with the Popgene 1.32 software (Yeh and Boyle, 1987 ). The gene differentiation among genetic clusters (Gst) was calculated with the Genetix Software 4.05.2 (Belkhir et al., 2004 ) using the unbiased estimator (Nei and Chesser, 1983 ). One hundred permutated data sets were also prepared with the Genetix software.

DNA sequence data analysis
The Staden package v1.4 (Bonfield, 2004 ) was used to obtain complete sequences from the partial readings, and ClustalW v1.82 (Thompson et al., 1994 ) was used to align them. The cluster analysis was done using the Kimura 2 parameter as an evolution model and neighbor-joining as a clustering method using the Phylip package (Felsenstein, 1989 ). DNAsp software 4.0.6 (Rozas et al., 2003 ) was used to calculate the recombination parameter R (Hudson, 1987 ); the minimum number of recombination events Rm (Hudson and Kaplan, 1985 ); the genetic differentiation between groups, Kst (Hudson et al., 1992 , equation 11); and the neutrality tests (Tajima, 1989 ; Fu and Li, 1993 ). Nucleotide diversity ({pi} [Nei, 1987 , equation 10.5] and {theta} [per site] [Nei, 1987 , equation 10.3]) and haplotype diversity (Nei, 1987 , equation 8.4) are means of the values calculated by DNAsp for two groups. To form these two groups, a randomly chosen allele from each accession was included in group 1 and the other allele in group 2.

RESULTS

AFLP and DNA sequence diversity
Scoring of the AFLP fragments in the range of 60–380 base pairs resulted in 298 bands, all of which were polymorphic. For S. muricatum, 204 of the 298 bands were present in at least one of the accessions, and all were polymorphic as well.

One thousand and sixty-six nucleotide sites of the MCC gene were examined. Of these, 676 correspond to noncoding regions (three introns and the 3' untranslated region) and 390 to coding fragments (three exons) (Fig. 1). Nucleotide substitutions amount to 9.5% in the noncoding sites and 3.5% in the coding regions. Four insertions/deletions (indels) were present, two corresponding to single nucleotides, one to 2 bp, and the other to 55 bp.


Figure 1
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 1. Multiple sequence alignment of variable positions in Solanum section Basarthrum accessions. Positions conserved relative to haplotype 1a are shown as dots and deletions as hyphens. Numbering is indicated above the alignment for each position. Indels between positions 944 and 988 are 55 nucleotides long. Location of exon–intron boundaries are shown by vertical empty lines

 
A total of 29 haplotypes were considered (Fig. 1). Of these, S. muricatum presents seven, S. caripense seven, S. basendopogon four, and S. tabanoense two; the remaining species were characterized by a single haplotype each. The complete nucleotide sequences were deposited at GenBank (accession numbers EF200591–EF200696). The heterozygosity for the MCC locus in S. muricatum is 0.5. The haplotypes muricatum 3a and 3b, which represent 9.6% of the haplotypes found in S. muricatum, are identical to the S. caripense haplotypes caripense 1a and caripense 1b. Solanum heiseri has a haplotype identical to S. caripense haplotype caripense 1a and to S. muricatum haplotype muricatum 3a, and the S. filiforme haplotype has the pepino haplotype muricatum 1b.

Tajima and Fu and Li's tests were performed to test for neutrality on the S. muricatum and S. caripense sequence sets. Nonsignificant results were obtained with both tests (data not shown).

Relationships between cultivated and wild relatives
The AFLP data were subjected to a series of PCoA analyses. In the first PCoA, all the wild and cultivated accessions were included (Fig. 2A). In this case, the two main axes account for 27.7% of the variation. Despite the distance between the main S. muricatum group and the species of series Caripensia, a continuous dispersion of accessions is found between them. The S. muricatum accessions located closer to series Caripensia accessions are: SL, Popayan, 751, EC-12, and 868, and as indicated in Table 1, these are considered putative hybrids or introgressed forms (the S. muricatum sensu lato group). The species furthest from S. muricatum (S. canense, S. basendopogon, S. catilliflorum, and S. perlongistylum) were removed to more carefully examine the relationships among S. muricatum and the most closely allied wild relatives, and the PCoA was rerun. In this new analysis (data not shown), S. trachycarpum lies far away in the second axis from the group formed by S. muricatum and the remaining species of the series Caripensia, so the PCoA analysis was run again without S. trachycarpum. This new analysis (Fig. 2B) shows that the group formed by S. muricatum sensu stricto plus S. filiforme and S. cochoae are separated in the first axis from the wild species. The S. muricatum sensu lato accessions and the odd S. caripense PI-243342 are located in the middle of these two groups.


Figure 2
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 2. Principal coordinate analysis (PCoA) plot of (A) Solanum muricatum and all studied wild species of Solanum section Basarthrum, (B) S. muricatum with species only from the S. caripense complex, and (C) accessions of S. muricatum s.s. In (C), each accession is represented by its haplotype composition. Axis labels indicate the percentage explained by the first (dim1) and second (dim2) dimensions of the PCoA

 
A phenogram was constructed with the AFLP data (Fig. 3A). All the S. muricatum accessions are grouped under a node supported by an 89% bootstrap value. This group also includes S. cochoae, S. filiforme, and S. caripense PI-243342. All S. muricatum sensu lato accessions (except ‘Popayan' and SL) are grouped together in one part of the diagram in a basal position in relation to the bulk of the wild species. The lack of boostrap support in the structure of the lower nodes makes it difficult to interpret which of the rest of the wild species is most closely associated with the pepino.


Figure 3
View larger version (29K):
[in this window]
[in a new window]

 
Fig. 3. Trees based on neighbor-joining analysis of (A) AFLP data of all accessions included in the study and (B) haplotypes derived from the MCC gene sequence. Haplotype codes are indicated in Fig. 1. In both trees, branch lengths are proportional to distance. Bootstrap values greater than 50% are shown in both trees. Bars represent the genetic distances

 
Structure of variation in the cultigen
The AFLP data were subjected to a third PCoA that focused only on the S. muricatum sensu stricto accessions (Fig. 2C). Even though a continuous distribution is evident, the S. muricatum sensu stricto accessions can be assembled into three genetic clusters that appear after the construction of a neighbor-joining tree built with the AFLP data from the S. muricatum sensu stricto accessions (data not shown). Two clusters (labeled 1 and 2) are clearly differentiated (Fig. 2C) and were supported by bootstrap values of 40 and 55, respectively, in the AFLP-based phenogram (following a similar approach to that of Harter et al., 2006). Cluster 3 seems to be intermediate between clusters 1 and 2.

Genetic cluster 1 is centered in Ecuador, with an outlier in southern Peru (Fig. 4). Genetic cluster 2 is located in Peru and Ecuador. Both of these clusters include only traditional landraces from the Andean region. Cluster 3 is a mixture of traditional varieties from Peru and Ecuador as well as modern cultivars developed all around the world.


Figure 4
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 4. Geographic locations of the Andean Solanum muricatum accessions. Different symbols represent accessions from different S. muricatum genetic clusters (from Fig. 2C): open circles for genetic cluster 1, solid circles for cluster 2, gray circles for cluster 3

 
The genetic diversity within the genetic clusters of S. muricatum is relatively high and quite variable (Table 3). The genetic cluster 2 is the least diverse based on AFLP estimates and nucleotide diversity. Genetic cluster 3, which, apart from local landraces, contains the modern cultivars, had the greatest diversity. Solanum muricatum is as variable as the very widespread wild species S. caripense; perhaps not surprisingly, genetic cluster 3 by itself is almost as diverse as S. caripense.


View this table:
[in this window]
[in a new window]

 
Table 3. Estimates of diversity based on AFLP (h; Nei, 1973 ) and sequence-based indexes ({theta} [per site] [Nei, 1987 , equation 10.3], nucleotide diversity {pi} [Nei, 1987 , equation 10.5], and haplotype diversity Hd [Nei, 1987 , equation 8.4]) for Solanum muricatum and the wild species with a larger number of accessions

 
The haplotype diversity data also confirm that S. muricatum is a highly diverse species (Table 3). The S. muricatum haplotypes are widely dispersed in the neighbor-joining tree constructed using the MCC gene data (Fig. 3B). For instance, two of the haplotypes of S. muricatum are grouped with those of S. heiseri, S. fraxinifolium, and the S. caripense haplotypes (all except caripense 2). Three others (muricatum 1a, 1b, 1c) are linked to S. filiforme and, with an 86% bootstrap value, to the former group. Haplotype muricatum 4 is quite different from the other S. muricatum haplotypes and is nearly identical to the shared haplotype found in S. catilliflorum and S. perlongistylum.

The positions of three of the S. muricatum haplotypes mu1a, mu1b, and mu1c in the tree (Fig. 3B) could indicate that other unstudied materials were the source of some of the variation in the pepino. However, careful study of the data itself, i.e., the sequences given in Fig. 1, shows that these haplotypes could result from recombination within the gene studied. For example, haplotypes muricatum 1b and 2 accumulate their 11 nucleotide differences in a fragment of just 316 bp while the rest of the sequence is identical. And haplotype muricatum 1b could result from a recombination between two S. caripense haplotypes (caripense 2 and caripense 1b) plus four additional mutations. The statistics testing genetic differentiation among species also support the contention that the cultivated pepino and the wild relatives share much of the molecular diversity described. In support of that hypothesis, note that only 9% of the markers in S. muricatum sensu stricto are unique (i.e., not found in the wild species of series Caripensia). Adding further support to this argument is that two thirds of the markers in the wild species are found within S. muricatum sensu stricto.

DISCUSSION

The origin of most domesticates turns out to be more complicated than supposed at first analysis and may involve different scenarios, such as polyphyletic origins and the existence of complex interrelationships among the wild relatives and the domesticate (Olsen and Schaal, 1999 ; Nesbitt and Tanksley, 2002 ; Clark et al., 2004 ; Sukhotu et al., 2004 ). The evolutionary history of the pepino is no exception. Four decades of previous study have yielded many hypotheses on the origin of this Andean cultigen (e.g., Correll, 1962 ; Heiser, 1964 , 1969 ; Brücher, 1966 ). The earliest hypotheses suggested different single species as possible progenitors (e.g., Heiser, 1964 ; Brücher, 1966 ). On the basis of a wide range of analyses utilizing all the tools in systematic botany/evolutionary research, indicate that, other species have probably been involved in the diversification of the pepino through post-origin hybridization, even if the pepino originated from a single species (e.g., Anderson and Jansen, 1998 ; Prohens et al., 2003 ). The molecular tools available over the last 15 years have made our hypotheses about the origin of domesticates, the species, locations, and especially the underlying processes (e.g., interspecific hybridization) much more precise. The genetic data we present here, based on two complementary types of molecular data, strengthen our understanding of the origins of this complicated cultigen, and we hope they also demonstrate that the origin and evolution of domesticates—a process involving human manipulation—is not the simple one-directional process often envisioned.

Relationships between the cultigen and the wild relatives
The AFLP data indicate that S. muricatum is genetically close to S. filiforme, S. cochoae, and S. caripense PI-243342, relationships that could lead to the interpretation that these accessions are the wild ancestors of pepino. However, we prefer to be cautious and to take into account other information from other studies that indicate that these accessions represent special cases. Solanum caripense accession PI-243342 is quite different from the rest of the S. caripense accessions and became part of our study via stock from a seed bank. Because of its reputed origin from an area near the northern edge of the range of S. caripense (Costa Rica) and considerably outside of the ancient range for S. muricatum and because it resembles materials derived from artificial hybrids between S. caripense and S. muricatum, we suggest that this unusual accession may be derived from hybridization between the original Costa Rican S. caripense accession and some material of S. muricatum, presumably during its repeated multiplication ex situ in germplasm collections. Solanum filiforme and S. cochoae are rare species, and only one accession of each is available. The haplotype found in S. filiforme is very similar to those of S. muricatum, while that from S. cochoae is identical to one of the S. caripense haplotypes. Thus, these species could be true wild species closely related to the origin of S. muricatum or, more likely, stabilized hybrids (and a fertile, sexually reproducing entity in the case of S. cochoae; Anderson and Bernardello, 1991 ) between S. muricatum and a wild species, probably the widespread and highly polymorphic S. caripense.

Apart from the three exceptions mentioned, S. muricatum is not linked with a single wild species either in the AFLP or in the haplotype trees. Furthermore, in the haplotype tree, S. muricatum sequences are dispersed through the tree. This suggests that several wild species have contributed to the origin and evolution of S. muricatum. A similar lack of association of the domesticate with a single wild species and the dispersion of the cultigen across parts of the tree were described previously with cpDNA data in S. muricatum (Anderson et al., 1996 ). Analogous scenarios have been described for other cultivated species (e.g., Olsen and Schaal, 1999 ; Clark et al., 2004 ). It seems clear from the haplotype data that several wild species have either contributed to the S. muricatum genome or have become associated with it through hybridization. For instance, haplotypes muricatum 3a and 3b are identical to caripense haplotypes 1a and 1b from S. caripense, and haplotype muricatum 4 is only two nucleotides different from the S. catilliflorum and S. perlongistylum haplotypes. This hypothesis of hybridization is strengthened by the fact that the haplotypes are not only found in the putative pepino x wild species hybrids (S. muricatum sensu lato) but also in some of the S. muricatum sensu stricto accessions. However, some of the S. muricatum haplotypes (i.e., muricatum 1a, 1b and 2) are found only in the cultigen (as well as in S. filiforme, whose haplotype is identical to muricatum 1b).

The haplotypes muricatum 3a, 3b, and 4 found in some accessions of S. muricatum are likely the result of post-origin hybridization, perhaps as a result of "hybrid capture" (Rieseberg and Soltis, 1991 ; Mason-Gamer et al., 1995 ; Papa and Gepts, 2003 ). The genetic flow between S. muricatum and related wild species is to be expected, given that this cultigen is grown in the natural area of distribution of its wild relatives (Heiser, 1964 ; Anderson, 1975 , 1977 ). In fact, several putative natural hybrids have been identified (via morphology and/or molecular variation) in this study. Furthermore, hand-pollinated hybrids between the pepino and various wild species are relatively easy to make in greenhouse and garden cultures (Anderson and Jansen, 1998 ; Prohens and Nuez, 2001 ). Part of the haplotype richness in the pepino could be the consequence of hybridizations at several places and at several times, and the lack of genetic or geographic barriers today, and presumably in the past, between the cultivated and the wild species could explain the high diversity in S. muricatum (Anderson et al., 1996 ; Prohens et al., 2003 ). This is not the case in other cultivated relatives like tomato (Nesbitt and Tanksley, 2002 ), which was domesticated far from the natural area of distribution of most of its wild relatives and has a limited diversity.

We believe that it is very likely that recombinations are present and that their existence will confuse the relationships shown by the haplotype tree. We consider the existence of the few nodes with bootstrap values greater than 70% to be one indication of recombination. When only nodes with more than 70% support are considered, a tree with very low resolution and with no significant relationships results. For instance, the haplotype distinguishing S. canense, the most distant species based on morphological, ecological (Anderson et al., 1996 ), and genetic data (Prohens et al., 2006 ), does not place this species at a significant distance from the others. Alternative trees were constructed using maximum likelihood, Bayesian, and parsimony aproaches with similar results (data not shown). The likely reason for the failure of these methods is that all assume no recombination. Network approaches also provided no resolution. A similar lack of concordance between the haplotype tree and the species tree has been described for Manihot spp. (Olsen and Schaal, 1999 ). This situation could be explained by a recent origin of these wild species. A similar complex situation has been found in the wild relatives of other domesticated species in the Solanaceae (Sukhotu et al., 2004 ). Given all of this, we can conclude that it is the species in series Caripensia that are the closest wild relatives (given the S. muricatum haplotypes muricatum 1a, 1b, 1c, 3a, and 3b and typical haplotypes of the series Caripensia all grouped together, supported by an 86% boostrap value). However, it is not possible to infer exactly which wild species may have contributed the unique pepino haplotypes (muricatum 1a, 1b, 1c, and 2).

The complex origin of S. muricatum could help explain why the AFLP-based tree does not show clear-cut relationships among the cultivated and the wild species (except for S. filiforme, S. cochoae, and the odd S. caripense PI-243342). Previous proposals suggested S. tabanoense and S. caripense as possible progenitors of S. muricatum (Anderson et al., 1996 ). Although the participation of S. caripense is supported by the haplotype data herein, the involvement of S. tabanoense is not as clear from these data. Chloroplast RFLP DNA data, however, strongly implicate S. tabanoense in the origin of the pepino as well (Anderson et al., 1996 ). Furthermore, hybrids between the cultigen and S. tabanoense are easy to make (Heiser, 1964 , 1969 ; Anderson, 1979 ), and there is by far the greatest morphological similarity between the fruits of S. tabanoense and some cultivars of pepino (Heiser, 1964 , 1969 ). In addition, the simple leaves of typical S. tabanoense mirror those of some pepino cultivars. Thus, we would not dismiss the role of this species in the origin and evolution of the pepino.

Variation structure within the cultigen
Solanum muricatum varies considerably in both the AFLP and sequence data. Only the materials studied corresponding to the widespread wild species S. caripense have a diversity comparable to that of the cultivated species. A similar result for these species was reported in the cpDNA RFLPs study (Anderson et al., 1996 ), although the variation in S. muricatum was not as high as that described here, probably because of the nature of the markers used. Together, these results suggest that there have been no bottlenecks associated with the domestication of the pepino. The pepino also showed overall high heterozygosity, likely due to its high diversity per se, as well as to its reproductive behavior in cultivation, which is based primarily on vegetative propagation, a mode that favors heterotic hybrids (Rodríguez-Burruezo et al., 2003 ). The variation in this domesticate, the pepino, is notable in comparison to the much more important congeneric domesticate (Spooner et al., 1993 ), the tomato. That is, the tomato shows much less genetic diversity compared with its closest wild relative S. pimpinellifolium L. (Bretó et al., 1993 ; Rus-Kortekaas et al., 1994 ) than does the pepino with its closest relative. Perhaps this again indicates that the tomato was domesticated in Mexico, far from most of its related wild species in South America.

The AFLP and sequence data indicate that there is some intraspecific differentiation in the pepino, although there are no strongly isolated groups. The clusters 1 and 3, which are centered in the northern Andean area, are more diverse than cluster 2, which is centered in Peru. The genetic diversity of the pepino in the northern areas is considerably increased when the S. muricatum sensu lato accessions are added. However, adding these accessions may not make much sense, because they clearly involve selection. from many unknown stocks around the world and include material judged to be hybrids or backcross products. Pepino diversity, however, may also be substantial in these northerly areas. That is, there may be more hybridization with wild species in the north, because in the north pepinos have been and are regularly being cultivated in kitchen gardens or small fields adjacent to populations of the wild species (J. Prohens, personal observation). Alternatively or additionally, field work conducted some decades ago by Charles Heiser and Richard Schultes suggested that southern Colombia/northern Ecuador was a locus of possible origin of the pepino (Schultes and Romero-Castañeda, 1962 ; Heiser, 1964 ). That hypothesis was based on morphological diversity of pepinos and the fact that some of the fruits in that region bore seeds. The former would be reasonably strong evidence, but the latter is neither restricted to the Colombia/Ecuador region nor indicative of "primitiveness" because many pepino fruits, throughout the natural Andean range of this cultigen, bear seeds (Anderson, 1979 ). It has been proposed that the geographic area with the greatest diversity is likely to be the center of the species domestication (Vavilov, 1951 ; Harlan, 1992 ). In that case, northern Ecuador and southern Colombia could be the center of pepino domestication, with Peru constituting a secondary center and a more recent area of crop expansion.

We suggest that geographic differentiation of genetic diversity of cultivated pepinos could have been considerably weakened by the much greater human interchange among communities and countries in the past 50 years or so. The authors' experience, supplemented by personal communications from C. Heiser (a specialist in Andean-cultivated Solanaceae at the University of Indiana), indicates that there has been a dramatic change in markets, kitchen gardens, and local cultivation in the last half of the 20th century (Heiser, 1969 , 1985 ; Nuez et al., 1999 ). First, travel for local people in the Andes is now much easier. An indication of the greater interchange, and of the curiosity of gardeners, is that many crops from outside the region appear more prominently in markets (markets that, as a consequence, have lost much of their local or regional "flavor"). In addition, household kitchen gardens are less common today, and when they exist, the crops in them are often not local. And, finally, there are now even commercial field-scale production systems for crops such as the pepino that previously came to market primarily from small, local kitchen gardens. Such mass production systems not only introduce new commercially developed varieties into areas, but also may swamp out the local forms in markets. In addition, of course, botanists and horticulturalists collected pepinos and other crops and developed new cultivars, leading to confusing patterns of local landraces and eventually to the homogenization of local agriculture. Thus, it would actually be more surprising if the geographic patterns of variation of cultivated species such as the pepino were not heterogeneous and ambiguous. One would thus expect a relatively weak signal in the genetic structure of geographic groups, as we have found in this study.

The high diversity in the breeding materials from outside the Andean region (included in genetic cluster 3) is notable; this species seems to have avoided the typical bottleneck associated with the spread of the cultigen from its region of origin to the rest of the world. One possible explanation for this unusually high diversity could be related to the heterosis previously described in this cultivated species. Rodríguez-Burruezo et al. (2003) demonstrated that the greater the genetic distance among parents in the cultivated pepino, the greater the hybrid vigor of the offspring—the result expected. Thus, modern plant breeders would have been drawn to the greater vigor and diversity displayed by intercultivar hybrids. Of course, botanists and plant breeders (including the present authors) are also drawn to "new'" diversity, novelties, and forms, and thus, new hybrid combinations also attract attention. This hypothesis is further supported by the known intercultivar hybrid ancestry of some of the accessions included (El Camino, Kawi, Sweet Round, and Puzol; Prohens et al., 2002 ).

Conclusions
The AFLP and haplotype data link S. muricatum to a group of wild species of the series Caripensia, although it is not possible to ascertain whether there is a single species genetically closest to the pepino. In this respect, there is genetic material from several wild species in the cultigen. However, not all haplotypes present in S. muricatum have been found in the wild accessions studied, indicating that other wild materials have contributed to the origin and evolution of S. muricatum. The highly diverse pepino retains a considerable proportion of the diversity present in its wild relatives. During domestication and subsequent selection, the pepino seems not to have passed through the same stringent bottleneck as some other related domesticates (e.g., the tomato). That it is likely a polyphyletic species and that it is intercompatible with several sympatric wild species from series Caripensia may account for this high genetic diversity. Several accessions of S. muricatum sensu lato that are intermediate between S. muricatum sensu stricto and the wild relatives make a strong argument for the (regular) occurrence of gene flow. These results indicate that domestication does not always result in a reduced diversity in the cultigen.

FOOTNOTES

1 The authors thank the following for support: the National Science Foundation, the Dean of the University of Connecticut College of Liberal Arts and Sciences, the Ministerio de Ciencia y Tecnología (RF2004-00002-00–00), the European Union (RESGEN PL98–113), and the Universidad Politécnica de Valencia. M. Anderson assisted with field collections, C. Morse and C. Martine helped with greenhouse work, M. Plazas and A. Rodríguez assisted with greenhouse and molecular work, and M. Opel provided critical comments on an earlier draft of the manuscript. The authors are grateful to these contributors and also to C. Heiser, whose work originally sparked their interest in pepino. Back

4 Author for correspondence (jprohens{at}btc.upv.es ) Back

LITERATURE CITED

Anderson G. J.. 1975. The variation and evolution of selected species of Solanum, section Basarthrum. Brittonia 27: 209-222.[CrossRef][ISI]

Anderson G. J.. 1977. The variation and evolution of selected species of Solanum, section Basarthrum (Solanaceae). II. Brittonia 29: 116-128.[CrossRef][ISI]

Anderson G. J.. 1979. Systematic and evolutionary consideration of species of Solanum section Basarthrum. In J. G. Hawkes, R. N. Lester, and A. D. Skelding [eds.], The biology and taxonomy of the Solanaceae 549-562 Linnean Society Symposium Series No. 7. Academic Press, London, UK.

Anderson G. J. Bernardello L. M.. 1991. The relationships of Solanum cochoae, a new species from Peru. Novon 1: 127-133.[CrossRef]

Anderson G. J. Jansen R. K.. 1998. Biosystematic and molecular systematic studies of Solanum section Basarthrum and the origin and relationships of the pepino dulce (S. muricatum). Monographs in Systematic Botany from the Missouri Botanical Garden 68: 17-32.

Anderson G. J. Jansen R. K. Kim Y.. 1996. The origin and relationships of the pepino, Solanum muricatum (Solanaceae): DNA restriction fragment evidence. Economic Botany 50: 369-380.[ISI]

Anderson G. J. Martine C. T. Prohens J. Nuez F.. 2006. Solanum perlongistylum and S. catilliflorum, new endemic Peruvian species of Solanum, section Basarthrum, are close relatives of the domesticated pepino, S. muricatum. Novon 16: 161-167.[CrossRef][ISI]

Anderson G. J. Steinharter T. P. Cooper-Driver G.. 1987. Foliar flavonoids and the systematics of Solanum section Basarthrum. Systematic Botany 12: 534-540.[CrossRef][ISI]

Belkhir K. Borsa P. Chikhi L. Raufaste N. Bonhomme F.. 2004. GENETIX 4.05, logiciel sous Windows TM pour la génétique des populations Laboratoire Genome, Populations, Interactions, CNRS UMR 5000, Université de Montpellier II, Montpellier, France.

Benham J. Jeung J. U. Jasieniuk M. Kanazin V. Blake T.. 1999. Genographer: a graphical tool for automated fluorescent AFLP and microsatellite analysis Department of Plant Science, Montana State University, Bozeman, Montana, USA.

Bernardello L. M. Anderson G. J.. 1990. Karyotypic studies in Solanum section Basarthrum (Solanaceae). American Journal of Botany 77: 420-431.[CrossRef][ISI]

Bonfield J.. 2004. Staden package, version 1.4 Available at http://staden.sourceforge.net.

Bretó M. P. Asins M. J. Carbonell E. A.. 1993. Genetic variability in Lycopersicon species and their genetic relationships. Theoretical and Applied Genetics 86: 113-120.[ISI]

Brücher H.. 1966. Solanum caripense HBK (subsect. Basarthrum) in Venezuela. Feddes Repertorium 73: 216-221.

Buntjer J. B.. 1997. Phylogenetic computer tools, version 1.3 Wageningen University, Wageningen, Netherlands.

Clark A. G.. 1990. Inference of haplotypes from PCR-amplified samples of diploid populations. Molecular Biology and Evolution 7: 111-122.[Abstract]

Clark R. M. Linton E. Messing J. Doebley J. F.. 2004. Pattern of diversity in the genomic region near the maize domestication gene tb1. Proceedings of the National Academy of Sciences, USA 101: 700-707.[Abstract/Free Full Text]

Correll D. S.. 1962. The potato and its wild relatives Texas Research Foundation, Renner, Texas, USA.

Dawes S. N. Pringle G. J.. 1983. Subtropical fruits from South and Central America. In G. Wratt and H. C. Smith [eds.], Plant breeding in New Zealand 33-35 Butterworths, Wellington, New Zealand.

Felsenstein J.. 1989. PHYLIP—phylogeny inference package, version 3.2. Cladistics 5: 164-166.

Fu Y. X. Li W. H.. 1993. Statistical tests of neutrality of mutations. Genetics 133: 693-709.[Abstract]

Harlan J. R.. 1992. Crops and man American Society of Agronomy, Madison, Wisconsin, USA.

Harter A. V. Gradner K. A. Falush D. Lentz D. L. Bye R. A. Rieseberg L. H.. 2004. Origin of extant domesticated sunflowers in eastern North America. Nature 430: 201-205.[CrossRef][Medline]

Heiser C. B.. 1964. Origin and variability of the pepino (Solanum muricatum): a preliminary report. Baileya 12: 151-158.

Heiser C. B.. 1969. Nightshades: the paradoxical plants Freeman, San Francisco, California, USA.

Heiser C. B.. 1985. Of plants and people University of Oklahoma Press, Norman, Oklahoma, USA.

Hudson R. R.. 1987. Estimating the recombination parameter of a finite population model without selection. Genetical Research 50: 245-250.[ISI][Medline]

Hudson R. R. Boos D. D. Kaplan N. L.. 1992. A statistical test for detecting geographic subdivision. Molecular Biology and Evolution 9: 138-151.[Abstract]

Hudson R. R. Kaplan N. L.. 1985. Statistical properties of the number of recombination events in the history of a sample of DNA sequences. Genetics 111: 147-164.[Abstract/Free Full Text]

Jones C. J. Edwards K. J. Castaglione S. Winfield M. O. Sala F. van de Wiel C. Bredemeijer G. Vosman B. Matthes M. Daly A. Brettschenider R. Bettini P. Buiatti M. Maestri B. Malcevschi A. Marmiroli N. Aert R. Volckaert G. Rueda J. Linacero R. Vázquez A. Karp A.. 1997. Reproducibility testing of RAPD, AFLP and SSR markers in plants by a network of European laboratories. Molecular Breeding 3: 381-390.[CrossRef][ISI]

Kardolus J. P. van Eck H. J. van den Berg R. G.. 1998. The potential of AFLPs in biosystematics: a first application in Solanum taxonomy (Solanaceae). Plant Systematics and Evolution 210: 87-103.[CrossRef][ISI]

Kimura M.. 1983. The neutral theory of molecular evolution. Cambridge University Press Cambridge, UK.

Koopman W. J. M. Zevenbergen M. J. van den Berg R. G.. 2001. Species relationships in Lactuca s.l. (Lactucaceae, Asteraceae) inferred from AFLP fingerprints. American Journal of Botany 88: 1881-1887.[Abstract/Free Full Text]

Mason-Gamer R. J. Holsinger K. E. Jansen R. K.. 1995. Chloroplast DNA haplotype variation within and among populations of Coreopsis grandiflora. Molecular Biology and Evolution 12: 371-381.[ISI]

McKean A. L. Ke J. Song J. Che P. Achenbach S. Nikolau B. J. Wurtele E. S.. 2000. Molecular characterization of the non-biotin-containing subunit of 3-methylcrotonyl-CoA carboxylase. Journal of Biological Chemistry 275: 5582-5590.[Abstract/Free Full Text]

Morley-Bunker M. J. S.. 1983. A new commercial crop, the pepino (Solanum muricatum, Ait.) and suggestions for further development. Annual Report of the Royal New Zealand Institute of Horticulture 11: 8-19.

Nei M.. 1973. Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Sciences, USA 70: 3321-3323.[Abstract/Free Full Text]

Nei M.. 1987. Molecular evolutionary genetics Columbia University Press, New York, New York, USA.

Nei M. Chesser R. K.. 1983. Estimation of fixation indices and gene diversities. Annals of Human Genetics 47: 253-259.[ISI][Medline]

Nei M. Li W. H.. 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proceedings of the National Academy of Sciences, USA 76: 5269-5273.[Abstract/Free Full Text]

Nesbitt T. C. Tanksley S. D.. 2002. Comparative sequencing in the genus Lycopersicon: implications for the evolution of fruit size in the domestication of cultivated tomatoes. Genetics 162: 365-379.[Abstract/Free Full Text]

Nuez F. Morales R. Prohens J. Fernández de Córdova P. Soler S. Valdivieso E. Solórzano V.. 1999. Germplasm of Solanaceae horticultural crops in the south of Ecuador. Plant Genetic Resources Newsletter 120: 44-47.

Nuez F. Prohens J. Blanca J. M.. 2004. Relationships, origin, and diversity of Galapagos tomatoes: implications for the conservation of natural populations. American Journal of Botany 91: 86-99.[Abstract/Free Full Text]

Nuez F. Ruiz J. J.. 1996. El pepino dulce y su cultivo Food and Agricultural Organization of the United Nations, Rome, Italy.

Olsen K. M. Purugganan M. D.. 2002. Molecular evidence on the origin and evolution of glutinous rice. Genetics 162: 941-950.[Abstract/Free Full Text]

Olsen K. M. Schaal B. A.. 1999. Evidence on the origin of cassava: phylogeography of Manihot esculenta. Proceedings of the National Academy of Sciences, USA 96: 5586-5591.[Abstract/Free Full Text]

Papa R. Gepts P.. 2003. Asymmetry of gene flow and differential geographical structure of molecular diversity in wild and domesticated common bean (Phaseolus vulgaris L.) from Mesoamerica. Theoretical and Applied Genetics 106: 239-250.[CrossRef][ISI][Medline]

Prohens J. Anderson G. J. Blanca J. M. Cañizares J. Zuriaga E. Nuez F.. 2006. The implications of AFLP data for the systematics of the wild species of Solanum section Basarthrum. Systematic Botany 31: 206-214.

Prohens J. Anderson G. J. Rodríguez-Burruezo A. Nuez F.. 2003. Exploiting wild species for the genetic improvement of the pepino (Solanum muricatum). Journal of Applied Botany 77: 21-27.

Prohens J. Leiva-Brondo M. Rodríguez-Burruezo A. Nuez F.. 2002. ‘Puzol': a facultatively parthenocarpic hybrid of pepino. HortScience 37: 418-419.[Free Full Text]

Prohens J. Nuez F.. 2001. The use of wild species in the improvement of pepino (Solanum muricatum). In G. Barendse, G. van den Berg, T. Mariani, and G. van der Weerden [eds.], Solanaceae V: advances in taxonomy and utilization 297-306 Nijmegen University Press, Nijmegen, Netherlands.

Prohens J. Ruiz J. J. Nuez F.. 1996. The pepino (Solanum muricatum, Solanaceae): a "new" crop with a history. Economic Botany 50: 255-268.

Rieseberg L. H. Soltis D. E.. 1991. Phylogenetic consequences of cytoplasmic flow in plants. Evolutionary Trends in Plants 5: 65-84.[ISI]

Rodríguez-Burruezo A. Prohens J. Nuez F.. 2003. Performance of hybrid segregating populations of pepino (Solanum muricatum) and its relation to genetic distance among parents. Journal of Horticultural Science and Biotechnology 78: 911-918.

Rohlf F.. 1996. NTsys-pc: numerical taxonomy and multivariate system, version 2.0 Exeter Software, Soetauhet, New York, USA.

Rozas J. Sanchez-DelBarrio J. C. Messeguer X. Rozas R.. 2003. DnaSP, DNA polymorphisms analyses by the coalescent and other methods. Bioinformatics 19: 2496-2497.[Abstract/Free Full Text]

Rus-Kortekaas W. Smulders M. J. M. Arens P. Vosman B.. 1994. Direct comparison of levels of genetic variation in tomato detected by a GACA-containing microsatellite probe and by random amplified polymorphic DNA. Genome 37: 375-381.[Medline]

Schaal B. A. Olsen K. M.. 2000. Gene genealogies and population variation in plants. Proceedings of the National Academy of Sciences, USA 97: 7024-7029.[Abstract/Free Full Text]

Schultes R. E. Romero-Castañeda R.. 1962. Edible fruits of Solanum in Colombia. Harvard University Botanical Museum Leaflets 19: 235-286.

Song B. H. A. Clauss M. J. Pepper A. Mitchell-Olds T.. 2006. Geographic patterns of microsatellite variation in Boechera stricta, a close relative of Arabidopsis. Molecular Ecology 15: 357-369.[CrossRef][Medline]

Spooner D. M. Anderson G. J. Janssen R. K.. 1993. Chloroplast DNA evidence for the interrelationships of tomatoes, potatoes and pepinoes (Solanaceae). American Journal of Botany 80: 676-688.[CrossRef][ISI]

Spooner D. M. McLean K. Ramsay G. Waugh R. Bryan G. J.. 2006. A single domestication for potato based on multilocus amplified fragment length polymorphism genotyping. Proceedings of the National Academy of Sciences, USA 102: 14694-14699.[CrossRef][ISI]

Spooner D. M. Peralta I. E. Knapp S.. 2005. Comparison of AFLPs with other markers for phylogenetic inference in wild tomatoes (Solanum L. section Lycopersicon (Mill.) Wettst). Taxon 54: 43-62.[ISI]

Sukhotu T. Kamijima O. Hosaka K.. 2004. Nuclear and chloroplast DNA differentiation in Andean potatoes. Genome 47: 46-56.[Medline]

Tajima F.. 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123: 585-595.[Abstract/Free Full Text]

Tanksley S. D. Ganal M. W. Prince J. P. de-Vicente M. C. Bonierbale M. W. Broun P. Fulton T. M. Giovannoni J. J. Grandillo S. Martin G. B. Messeguer R. Miller J. C. Miller L. Paterson A. H. Pineda O. Roder M. S. Wing R. A. Wu W. Young N. D.. 1992. High density molecular linkage maps of the tomato and potato genomes. Genetics 132: 1141-1160.[Abstract]

Thompson J. D. Higgins D. G. Gibson T. J.. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673-4680.[Abstract/Free Full Text]

Vavilov N. I.. 1951. The origin, variation, immunity, and breeding of cultivated plants Ronald Press, New York, New York, USA.

Vos P. Hogers R. Bleeker M. Reijans M. van de Lee T. Hornes M. Frijters A. Pot J. Peleman J. Kuiper M. 1995 AFLP: a new technique for DNA fingerprinting. Nucleic Acids Research 23: 4407-4414.

Yeh F. C. Boyle T. J. B.. 1987. Population genetic analysis of co-dominant and dominant markers and quantitative traits. Belgian Journal of Botany 129: 157.




This article has been cited by other articles:


Home page
Am. J. Bot.Home page
S. Bory, P. Lubinsky, A.-M. Risterucci, J.-L. Noyer, M. Grisoni, M.-F. Duval, and P. Besse
Patterns of introduction and diversification of Vanilla planifolia (Orchidaceae) in Reunion Island (Indian Ocean)
Am. J. Botany, July 1, 2008; 95(7): 805 - 815.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
B. Kilian, H. Ozkan, A. Walther, J. Kohl, T. Dagan, F. Salamini, and W. Martin
Molecular Diversity at 18 Loci in 321 Wild and 92 Domesticate Lines Reveal No Reduction of Nucleotide Diversity during Triticum monococcum (Einkorn) Domestication: Implications for the Origin of Agriculture
Mol. Biol. Evol., December 1, 2007; 24(12): 2657 - 2668.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blanca, J. M.