Am. J. Bot. Join the BSA
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Robba, L.
Right arrow Articles by Brodie, J.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Robba, L.
Right arrow Articles by Brodie, J.
Agricola
Right arrow Articles by Robba, L.
Right arrow Articles by Brodie, J.
(American Journal of Botany. 2006;93:1101-1108.)
© 2006 Botanical Society of America, Inc.


Phycology

Assessing the use of the mitochondrial cox1 marker for use in DNA barcoding of red algae (Rhodophyta)1

Lavinia Robba, Stephen J. Russell, Gary L. Barker and Juliet Brodie2

2Department of Botany, Natural History Museum, Cromwell Road, London SW7 5BD, UK; 3School of Biological Sciences, University of Bristol, Woodland Road, Bristol BS8 1UG, UK

Received for publication September 2, 2005. Accepted for publication April 29, 2006.

ABSTRACT

The red algae, a remarkably diverse group of organisms, are difficult to identify using morphology alone. Following the proposal to use the mitochondrial cytochrome c oxidase subunit I (cox1) for DNA barcoding animals, we assessed the use of this gene in the identification of red algae using 48 samples plus 31 sequences obtained from GenBank. The data set spanned six orders of red algae: the Bangiales, Ceramiales, Corallinales, Gigartinales, Gracilariales and Rhodymeniales. The results indicated that species could be discriminated. Intraspecific variation was between 0 and 4 bp over 539 bp analyzed except in Mastocarpus stellatus (0–14 bp) and Gracilaria gracilis (0–11 bp). Cryptic diversity was found in Bangia fuscopurpurea, Corallina officinalis, G. gracilis, M. stellatus, Porphyra leucosticta and P. umbilicalis. Interspecific variation across all taxa was between 28 and 148 bp, except for G. gracilis and M. stellatus. A comparison of cox1 with the plastid Rubisco spacer for Porphyra species revealed that it was a more sensitive marker in revealing incipient speciation and cryptic diversity. The cox1 gene has the potential to be used for DNA barcoding of red algae, although a good taxonomic foundation coupled with extensive sampling of taxa is essential for the development of an effective identification system.

Key Words: cytochrome c oxidase subunit I • DNA barcoding • species identification • red algae • Rubisco spacer

In recent years there has been a drive to speed up the rate at which species on earth are identified and described in response to the diversity of life which is disappearing at an ever-increasing rate. A major initiative by Hebert et al. (2003a) that has been advocated to achieve this goal is DNA barcoding, i.e., sequencing a short, diagnostic segment to discriminate between species. Indeed, Hebert et al. (2003a) consider DNA barcoding as the only way to sustain identification capability and have been leaders in driving this approach.

The use of DNA barcoding as a way to catalogue life has its critics. For example, Mallet and Willmot (2003) were concerned whether there would be enough DNA sequence differences between closely related species to enable discrimination. They also raised doubts over whether DNA taxonomy would become mandatory for all species descriptions. Ebach and Holdrege (2005) feared that DNA barcoding would replace traditional taxonomic practice and would result in newly "flagged" species never being formally described. Will et al. (2005) , although strongly in favor of using DNA for identification, considered using DNA sequences for this purpose "old hat." They also stated that using DNA barcoding to replace "normal" taxonomy for naming new species and studying their relationships was destructive. They did not, however, define what they meant by normal in this context. Counter to these arguments, DNA barcoding projects are already achieving positive results and will benefit, not compromise, taxonomic science (Gregory, 2005 ; Schindel and Miller, 2005 ). Hebert et al. (2004a) also pointed out that DNA barcoding is a valuable tool, especially when coupled with traditional taxonomic tools and is fundamental in revealing hidden diversity. Furthermore, Hebert and Gregory (2005) noted that opposition to the subject has arisen from misconceptions about DNA barcoding.

Until now, the emphasis of DNA barcoding has been on animals, using primarily one gene, mitochondrial cytochrome c oxidase subunit I (cox1). Hebert et al. (2003a , b ) have argued that a cox1-based identification system could be developed for all animals and have undertaken a number of studies on different animal groups (Hebert et al., 2004b , and references therein) which, with the exception of the Cnidaria, support their claim. Now, however, the algae and the higher plants are being considered for DNA barcoding and the search is on for molecular markers which can be successfully used across a wide spectrum of organisms for DNA barcoding. Whereas cox1 appears suitable for animals, it is not appropriate for most species of flowering plants because it has a much slower rate of evolution than in animals; the nuclear internal transcribed spacer (ITS) and the plastid trnH-psbA are being proposed as possible markers for flowering plants (Kress et al., 2005 ). However, it can be used in the red algae (Saunders, 2005 ).

The red algae (Rhodophyta) are an ancient and remarkably diverse group of organisms ranging from unicellular to complex, multicellular species that occur primarily in the marine environment throughout the world. The oldest known taxonomically resolved eukaryote is a red alga dated at 1198 ± 24 million years old (Butterfield, 2000 ), and this marks the onset of a major evolutionary radiation of eukaryotes. Ecologically, the red algae are members of the primary producers in the marine environment. They may form distinct zones on seashores and also occur in the shallow subtidal marine environment where algal communities provide nurseries for fisheries. Of the estimated 6000 species worldwide, some species of red algae are commercially important and may be cultivated for food or for compounds that are used in a wide range of industrial processes. However, the red algae remain a group of organisms with many species undescribed, and the exact number of species remains elusive. This is because they are extremely difficult to identify and classify on morphological grounds alone. Their morphology can be highly variable within and between species, and conspicuous features with which they can be readily identified are often lacking. In addition, highly convergent morphology is commonly encountered and often conceals cryptic species that have only come to light from molecular data. Identification is further compounded by the complexities of red algal life histories, many of which have a heteromorphic alternation of generations. Different life history stages of species have frequently been described as separate species and have only been linked through observations of life histories in culture and use of molecular techniques.

The adoption of molecular techniques in the 1980s for use in red algal taxonomy has enabled huge advances in our understanding of species and their relationships. For identification, we frequently use short sequences of DNA, typically in conjunction with morphological and culture work, to distinguish between species. For example, Maggs et al. (1992) used sequence data of the plastid-encoded intergenic Rubisco spacer and flanking regions (c. 350 bp) in the elucidation of the Gymnogongrus devoniensis complex in the North Atlantic. Brodie et al. (1996 , 1998 ) found the Rubisco spacer useful to distinguish between species of Porphyra in Britain and surrounding waters.

A number of other markers have been used in red algal taxonomy and these are reviewed in Provan et al. (2004) . Although most of these markers are useful for species level identification, some are not single copy or they may be long, requiring several primer series to obtain a complete sequence. Furthermore, as noted by Saunders (2005) , the use of different markers by different laboratories has made it difficult to make comparisons across the red algae. The success of cox1 in animals has led to the consideration of this marker for use in DNA barcoding the red algae (Saunders, 2005 ). In this paper, we have assessed the use of cox1 as a possible marker for DNA barcoding of red algae for species belonging to three orders of the Florideophyceae and, for the first time, species of the Bangiales, an order of the Bangiophyceae. We have a considerable database of Rubisco spacer sequences for members of the Bangiales, so we have compared these with the cox1 data for this order. For this study, we have focused primarily on material from the United Kingdom where the red algal flora has been well studied.

MATERIALS AND METHODS

Taxon sampling
A total of 32 individuals were sampled with, where possible, multiple accessions for each species (Table 1). The taxon sampling strategy was designed to cover a small but diverse selection of red algae from around the UK, covering species which have presented difficulties in identification using traditional techniques. Species of Bangiophyceae, Porphyra and Bangia (all marine) were selected because they are notoriously difficult to distinguish on morphological grounds, coupled with cryptic diversity and complex life histories, but are well documented for the UK (see Brodie and Irvine, 2003 ). For the Florideophyceae, the two species of Corallina that have been reported for the UK were chosen as examples of coralline algae, i.e., they have calcified thalli and are extremely difficult to distinguish morphologically. Gracilaria gracilis (Stackhouse) Steentoft, L.M. Irvine & Farnham was included because of the difficulty of distinguishing it from other morphologically similar species, notably Gracilariopsis gracilis (S.G. Gmelin) Steentoft, L.M. Irvine & Farnham (Steentoft et al., 1995 ). Mastocarpus stellatus (Stackhouse) Guiry has been shown to have two basic types of life history, one heteromorphic and the other isomorphic, and crossing studies have revealed two virtually non-breeding populations in the northeastern Atlantic (Guiry and West, 1983 ).


View this table:
[in this window]
[in a new window]
 
Table 1. Details of Rhodophyta taxa sampled and GenBank accession numbers for cox1 and Rubisco spacer sequences

 
DNA extraction, PCR amplification, and sequencing
Total DNA was extracted from ~ 0.1 g of fresh, silica gel preserved and herbarium specimens using a modified CTAB microextraction protocol (Doyle and Doyle, 1987 ). Extracted DNA was further purified, after a single isopropanol precipitation, using a GFX PCR DNA purification kit (Amersham Biosciences, USA), following the manufacturer's protocols. Mitochondrial cox1 sequences were obtained for all taxa samples. Replicates of both specimens and extracted DNA were made for Mastocarpus stellatus (JBLR7) and P. umbilicalis (JB334). Sequences of the plastid Rubisco spacer were only obtained for members of the Bangiophyceae (Table 1). Standard polymerase chain reaction (PCR) procedures were applied to amplify cox1 and the Rubisco spacer DNA fragments. Primers complementary to the cox1 region encoding for the cox1 subunit of the cytochrome c oxidase, were designed by Saunders (2005) : GazF1 5' TCAACAAATCATAAAGATATTGG 3' and GazR1 5'ACTTCTGGATGTCCAAAAAAYCA 3'. The Rubisco spacer region was amplified using RUB5 (5' TGTGGACCTCTACAAACAGC3'; Maggs et al., 1992 ) and RUB3Por (5' CCCATAATTCCCAGTA 3'; designed by G. Barker). Each PCR contained 5 µL of 10x NH4 buffer, 3 µL MgCl2, 0.5 µL of Taq (all from BIOTAQ DNA Polymerase kit, USA), 3 µL of dNTP (0.2 mM), 1 µL of forward primer (100 µM), 1 µL reverse primer (100 µM), 1µL of DNA template and 35.5 µL distilled water. PCR reactions were carried out using a Techne Thermal Cycler (USA). A standard protocol of PCR (1 cycle of 94°C for 2 min; 30 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 1 min; 1 cycle of 72°C for 5 min) was used for cox1 and Rubisco. Amplification products were purified using a GFX PCR DNA purification kit (as described). Dideoxy cycle sequencing (28 cycles: 30 s of denaturation at 95°C, 15 s of annealing at 50°C, 4 min of extension at 60°C) with ABI BigDye Terminators (version 1.1, USA) was performed in 10 µL volumes using PCR primers (10 µM) on a Hybaid Omnigene Thermal Cycler. Excess dye-labeled nucleotides from the sequence reactions were removed by standard ethanol–sodium acetate precipitation. Sequence products were subsequently re-suspended and run on a Perkin Elmer (UK) ABI 377 DNA sequencer.

Data analysis
Sequences were edited and assembled using SeqMan in the package DNAStar Lasergene Navigator (version 5, DNASTAR, USA). Verified sequences were then aligned in MegAlign DNAStar Lasergene Navigator (version 5, DNASTAR) and finally by eye. The complete data set used to construct the unweighted pair group method with arithmetic mean (UPGMA) tree (Fig. 1) used 539 bp of the cox1 gene in the analysis, included 88 taxa (Table 1; includes Porphyra leucosticta 4, which was 11 bp short and therefore not used in the UPGMA analysis). A PERL script was used to calculate the number of base differences between each pairwise combination of sequences.


Figure 1
View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. Phenogram from the unweighted pair group method with arithmetic mean (UPGMA) analysis of cox1 data for all taxa

 
UPGMA (Sneath and Snokal, 1973 ) analysis was performed using PAUP* version 4.0b10 (Swofford, 2003 ). This method uses a sequential clustering algorithm in which local homologies between the taxa sequences are identified in order of similarity. The UPGMA tree or phenogram is built in a stepwise manner and reflects the phenotypic similarities between sequences.

RESULTS

The cox1 sequences were obtained for 48 samples in addition to the 31 sequences from GenBank. The complete data set spanned six orders of red algae, the Bangiales in the Bangiophyceae and the Ceramiales, Corallinales, Gigartinales, Gracilariales and Rhodymeniales in the Florideophyceae. Species from one family of each order were sampled, with the exception of the Gigartinales, which included members of the Cystocloniaceae, Dumontiaceae, Gigartinaceae and Phyllophoraceae, and the Rhodymeniales, which included the Faucheaceae and Rhodymeniaceae. The results for those species whose data source are GW (Table 1) are covered in Saunders (2005) . The following section covers our results.

The UPGMA tree (Fig. 1) highlights the intraspecific genetic variation, the presence of cryptic species in some genera and illustrates that it is possible to discriminate between the species in the data set and that the orders and families to which these species belong are clearly separated using the cox1 marker.

Intraspecific variation
Intraspecific variation over the 539 bp used in the analysis was between 0 and 4 bp with two main exceptions. The first of these, Gracilaria gracilis, had one sample that was 11 bp different from three others that had identical sequences. These three came from the same shore region at Sidmouth, Devon, whereas the different sample came from Cornwall. Mastocarpus stellatus, with between 0 and 14 bp differences overall, showed the greatest intraspecific variation of all the species tested here, with differences within and between localities. Although there were only between 0 and 4 bp between samples, there was also notable variation within a third species, Porphyra umbilicalis, for which isolates fell into two main groups.

Cryptic diversity
In addition to G. gracilis, M. stellatus, and P. umbilicalis, cryptic diversity was found in three other species: Bangia fuscopurpurea, P. leucosticta and Corallina officinalis. In B. fuscopurpurea, samples 1 and 2 were identical, and both came from the same rock at Sidmouth, Devon, although collected 4 years apart. The third sample identified as B. fuscopurpurea, collected from Kimmeridge, Dorset, was 53 bp different from 1 and 2. Two species identified as P. leucosticta 1 and 2 have identical sequences, and a third, JB308, which was 11 bp short and therefore not used in the UPGMA analysis, was identical with these for its 526 bp. Another species identified as P. leucosticta was 52 bp different from 1 and 2. Corallina officinalis showed within-site variation of 0–3 bp at Sidmouth, but sample 2 from this site was identical to sample 3 from Jersey. However, another sample identified as C. officinalis differed by 28–30 bp. Porphyra dioica did not show cryptic diversity, with 0–2 bp difference. The sample of Chondrus crispus from England was an identical match to both samples of C. crispus, which were from Canada (northwest Atlantic).

Interspecific variation
At the interspecific level within genera, Corallina was the one genus in the Florideophyceae available here with more than one species, i.e., C. elongata and C. officinalis, and which differed by 90 bp. For interspecific differences within genera within the Bangiales, Porphyra fell into two distinct groupings, one containing P. umbilicalis, P. purpurea and P. dioica, with between 37 and 69 bp differences, and another with P. leucosticta, the cryptic species and P. rosengurttii, which ranged between 52 and 65 bp, whereas the difference between the two groups was greater than between themselves at 101–113 bp. All three samples identified as B. fuscopurpurea within the Bangiales, had greater base-pair differences between each group of Porphyra species but within the range (up to 99 bp) of difference between the two groups. Interspecific variation across all taxa was between 28 and 148 bp.

Comparison with Rubisco spacer data in the Bangiales
For species in the Bangiales, the variation shown in cox1 sequence data did not show up in the Rubisco spacer data where the sequences for P. dioica, P. umbilicalis and P. leucosticta were identical within each species and, along with P. purpurea, matched those reported previously reported for the UK (Brodie et al., 1998 ).

DISCUSSION

The results indicate that it is possible to discriminate between species of red algae using cox1 sequence data and thus this marker has the potential to be a powerful tool for DNA barcoding. These findings are in accordance with Saunders (2005) . The range of intraspecific difference within the Florideophyceae, apart from M. stellatus and G. gracilis, and within the Bangiophyceae, apart from P. umbilicalis, was the same as reported by Saunders at 0–2 bp. The difference between M. stellatus samples (0–12 bp) was similar to those reported by Saunders for the closely related species Mazzaella linearis (Setchell et Gardner) Fredericq and M. splendens (Setchell et Gardner) Fredericq (5–8 bp difference) and Dilsea carnosa (Schmidel) Kuntze and D. integra (7 bp difference). This suggests that Mastocarpus stellatus may represent a species complex. Evidence in support of this was presented by Guiry and West (1983) , who showed that M. stellatus in the North Atlantic had at least two life history types (sexual and "direct" or asexual) and at least two types of breeding populations, a northern one and southern one, which were virtually non-interbreeding. Zuccarello et al. (2005) , who used the Rubisco spacer and cox2–3 spacer, have confirmed Guiry and West's (1983) results and have suggested that differential organellar inheritance and hybrid formation of an asexual life history account for their results. Mastocarpus stellatus is morphologically highly variable, and Guiry and West (1983) noted that there were differences between the northern and southern populations. Our results do not indicate a clear north–south split within the UK, but the gross morphology between our two groups was distinct. Those in the upper group in Fig. 1 (groups 2, 3, 4, 8 and 14) had an open habit, were dark red in color and translucent at the tips, whereas those in the lower group (5, 6, 10, 11, 9, 1, 13, 12, 7) were compact in habit, black-red in color and opaque.

The sample of Gracilaria gracilis that differed by 11 bp from the other samples of this species raises the possibility of hidden diversity here. Gracilaria is the second largest genus of red algae (Brodie and Zuccarello, 2006 ) and has presented considerable problems in identification because of the highly variable morphology within species. For many years, Gracilaria gracilis was confused with Gracilariopsis longissima (from which it is clearly distinguishable here using cox1), with many misidentifications because of their similar morphology (Steentoft et al., 1994). The variation within Porphyra umbilicalis was also of note because samples fell into two groups. As with M. stellatus, it is morphologically very variable (Brodie and Irvine, 2003 ) and easily misidentified.

The variation observed within M. stellatus and G. gracilis and to a lesser extent P. umbilicalis, may be examples of incipient speciation. Whether there are any clearly definable morphological differences between the two groups is the subject of other studies. However, the data point to the need for more sampling of these genera to build a better picture of intraspecific variation.

Cryptic diversity was observed in all the orders of red algae that we studied. The cox1 sequence data distinguished the Bangia samples of this study and grouped them with the Porphyra species. That Bangia and Porphyra are not separate taxonomic entities, despite considerable morphological plasticity and molecular variability, has been shown on several separate occasions (Müller et al., 2005 and references therein). The Rubisco spacer sequence for B. fuscopurpurea being different from those previously reported for the UK highlights the need for much more sampling to determine diversity of these species.

The cryptic diversity found in P. leucosticta is not unexpected and has been found using other molecular markers, including rbcL and partial 18S (J. Brodie personal observation; I. Bartsch (Alfred-Wegener Institute for Polar and Marine Research, Germany) and C. Neefus (University of New Hampshire, US), personal communication). There are a number of other species that have gone under the name P. leucosticta (Holmes and Brodie, 2005 ), including P. rosengurttii which was originally described from North Carolina (Coll and Cox, 1977 ) and subsequently identified from the Mediterranean (J. Brodie, personal observation; I. Bartsch and C. Neefus, personal communication). The specimen used in this study was from a collection from the south coast of England in 2005 and is the first record of this species for the UK. The P. leucosticta complex in the North Atlantic and Mediterranean is currently the subject of other studies by our group.

The presence of an unknown species within Corallina is another example of the difficulties of identifying species that are morphologically very similar. An examination of the gross morphology of the three individuals that were 0–3 bp different with the unidentified species revealed nothing obvious, but as mentioned, point to the need for a reexamination of morphology and greater sampling effort.

The pattern of Porphyra species falling into two distinct groups was noted by Brodie et al. (1998) for the northeastern Atlantic and by Klein et al. (2003) for the northwestern Atlantic. The categorizing of these two groups into an Atlantic group and Pacific group by Brodie et al. (1998) was useful at the time, based on the data available, although increasingly a more complex picture with much greater diversity than originally thought is emerging based on morphological studies (see Jones et al., 2004 ; Nelson et al., 2005 ). The difference between the two Porphyra groups here of 102–116 bp, would equal a different generic status in the Florideophyceae. The level of separation shown by P. leucosticta (1 and 2), P. leucosticta (3), and P. rosengurttii in relation to the other species of Porphyra suggests that they may belong to a different genus. Furthermore, in addition to molecular evidence, morphological and reproductive data support this observation (Holmes and Brodie, 2005 ).

The absence of variation in Chondrus crispus from both sides of the North Atlantic is of note. The species is confined to the North Atlantic (Brodie et al., 1991 ) and, as in M. stellatus, morphologically extremely polymorphic. Crossing studies and molecular investigations have confirmed that there is only one species of Chondrus in the North Atlantic and that it is distinct from other species of the genus (Brodie et al., 1997 ; Chopin et al., 1996 ), although the species has been reported to show considerable genetic variation at the population level across short distances (Donaldson et al., 2000 ). It would clearly be valuable to obtain more data using cox1 to see if it is possible to determine any distinct lineages in the North Atlantic. Also of note is the closeness of Mazzaella sanguinea to C. crispus, which requires further investigation.

Rubisco spacer data has been widely used in the identification of Porphyra species in the Bangiales (Brodie et al., 1996 , 1998 ; Brodie and Nielsen, 2005 ), and although very useful, in comparison with cox1, it is less sensitive and is too short for phylogenetic analysis. However, the cox1 gene has the potential to yield insight into possible genetic lineages and to pick up very closely related species. Preliminary indications suggest that cox1 also has the potential to provide phylogenetic information and could be extremely valuable in this regard and help to provide additional information of species relationships.

Assessment of cox1 as a universal DNA barcoding tool for the red algae
The cox1 gene is a relatively short piece of DNA that can be readily amplified and sequenced with one set of primers. The evidence so far from Saunders (2005) and this paper indicates that cox1 can be used to identify species of red algae. Furthermore, using cox1, potential incipient speciation appears to be revealed, as indicated by the data for Mastocarpus stellatus and Porphyra umbilicalis. It also appears to be useful in revealing cryptic diversity, although this has also been demonstrated on numerous occasions in the red algae with plastid and nuclear markers. If all laboratories that engage in DNA barcoding of red algae use this marker, as advocated by Saunders (2005) , direct comparisons will be possible between wide geographical areas, as shown in the case of Chondrus crispus. In addition to identification, the marker has use in phylogenetic analysis and will be an additional data set to be used in conjunction with molecular and plastid markers. Data from cox1 also have the potential for use in conservation initiatives such as determining the genetic complement within a defined region. Such data would be useful for informed decision making by conservation bodies.

The data set presented here clearly indicates the potential of using cox1 for DNA barcoding. The results have highlighted several exciting areas for further research and contribute to ongoing studies, including the need for more critical morphological work. However, as also noted by Meyer and Paulay (2005) in relation to their work on cowries (cypraeid marine gastropods), the results also indicate that a good understanding of the taxonomy of red algae is required for interpretation of the data in order to develop an effective identification system using DNA barcodes. Meyer and Paulay (2005) also pointed out that clades need to be thoroughly sampled and it is clear from our results that a lot more data are required to establish the range of variation within species and across genera and that this will be necessary to develop an effective DNA barcoding system.

FOOTNOTES

1 The authors thank G. Saunders for primer sequences and his generous support for this work; B. Rinkel, M. Holmes, and I. Tittley for providing specimens and help in the field; also acknowledge an award from the Museum Research Fund at the Natural History Museum as part of Barcode of Life: the British Flora project, and support from J. Vogel and the DNA barcoding team at the museum. Back

2 Author for correspondence (J.Brodie{at}nhm.ac.uk ) Back

LITERATURE CITED

Brodie J. Guiry M. D. Masuda M.. 1991. Life history and morphology of Chondrus nipponicus (Gigartinales, Rhodophyta) from Japan. British Phycological Journal 26: 33-50.

Brodie J. Hayes P. K. Barker G. L. Irvine L. M.. 1996. Molecular and morphological characters distinguishing two Porphyra species (Rhodophyta: Bangiophycidae). European Journal of Phycology 31: 303-308.[CrossRef][ISI]

Brodie J. Hayes P. K. Barker G. L. Irvine L. M. Bartsch I.. 1998. A reappraisal of Porphyra and Bangia (Bangiophycidae, Rhodophyta) in the northeast Atlantic based on the rbcL-rbcS intergenic spacer. Journal of Phycology 34: 1069-1074.[CrossRef][ISI]

Brodie J. A. Irvine L. M.. 2003. Seaweeds of the British Isles, vol. 1, part 3B, Bangiophycidae Intercept, Hampshire, UK.

Brodie J. Masuda M. D. Mine I. Guiry M. D.. 1997. A comparative study of Chondrus pinnulatus f. pinnulatus and Chondrus pinnulatus f. armatus (Gigartinaceae, Rhodophyta). Journal of Phycology 33: 682-698.[CrossRef][ISI]

Brodie J. Nielsen R.. 2005. The diversity of the Bangiophycidae (Rhodophyta) of the Faroes in the context of the northern Atlantic. Biofar Proceedings Fróðskaparrit. Annales Societatis Færensis Supplementum XXXXI: 52-61.

Brodie J. Zuccarello G. C. In press Systematics of the species-rich algae: red algal classification, phylogeny and speciation. In R. Hodkinson, J. Parnell and S. Waldren [eds.] Towards the tree of life: taxonomy and systematics of species rich taxa. Systematics Association Series CRC Press, Boca Raton, Florida, USA.

Butterfield N. J.. 2000. Bangiomorpha pubescens n. gen., n. sp.: implications for the evolution of sex, multicellularity and the Mesoproterozoic–Neoproterozoic radiation of eukaryotes. Paleobiology 26: 386-404.[Abstract/Free Full Text]

Chopin T. Bird C. J. Murphy C. A. Osborne J. A. Patwary M. U. Floc'h J.-Y.. 1996. A molecular investigation of polymorphism in the North Atlantic red alga Chondrus crispus (Gigartinales). Phycological Research 44: 69-80.[CrossRef]

Coll J. Cox J.. 1977. The genus Porphyra C. Ag. (Rhodophyta, Bangiales) in the American North Atlantic. I. New species from North Carolina. Botanica Marina 20: 155-159.

Donaldson S. L. Chopin T. Saunders G. W.. 2000. An assessment of the AFLP method for investigating population structure in the red alga Chondrus crispus Stackhouse (Gigartinales, Florideophyceae). Journal of Applied Phycology 12: 25-35.[CrossRef][ISI]

Doyle J. J. Doyle J. L.. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry Bulletin 19: 11-15.

Ebach M. C. Holdrege C.. 2005. DNA barcoding is no substitute for taxonomy. Nature 434: 697.[Medline]

Gregory T. R.. 2005. DNA barcoding does not compete with taxonomy. Nature 434: 1067.[Medline]

Guiry M. D. West J. A.. 1983. Life history and hybridization studies on Gigartina stellata and Petrocelis cruenta. Journal of Phycology 19: 474-494.[CrossRef][ISI]

Hebert P. D. N. Cywinska A. Ball S. L. deWaard J. R.. 2003a. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London, B, Biological Sciences 270: 313-321.[CrossRef]

Hebert P. D. N. Gregory T. R.. 2005. The promise of DNA barcoding for taxonomy. Systematic Botany 54: 852-859.

Hebert P. D. N. Penton E. H. Burns J. M. Janzen D. H. Hallwachs W.. 2004a. Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Asteraptes fulferator. Proceedings of the National Academy of Sciences, USA 101: 14812-14817.[Abstract/Free Full Text]

Hebert P. D. N. Ratnasingham S. Dewaard J. R.. 2003b. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London, B, Biological Sciences (Supplement) 270: S96-S99.[CrossRef]

Hebert P. D. N. Stoeckle M. Y. Zemlak T. S. Francis C. M.. 2004b. Identification of birds through DNA Barcodes. PLoS Biology 2: e312.[CrossRef][Medline]

Holmes M. J. Brodie J.. 2005. Phenology and the life history in culture of Porphyra leucosticta (Bangiales, Rhodophyta) from Britain. Botanica Marina 48: 218-230.[CrossRef][ISI]

Jones W. A. Griffin N. J. Jones D. T. Nelson W. A. Farr T. J. Broom J. E.. 2004. Phylogenetic diversity in South African Porphyra (Bangiales, Rhodophyta) determined by Nuclear SSU sequence analysis. European Journal of Phycology 39: 197-211.

Klein A. S. Mathieson A. C. Neefus C. D. Cain D. F. Taylor H. A. Teasdale B. W. West A. L. Hehre E. J. Brodie J. Wallace A.. 2003. Identification of north-western Atlantic Porphyra (Bangiaceae, Bangiales) based on sequence variation in nuclear SSU and plastid rbcL genes. Phycologia 42: 109-123.[ISI]

Kress W. J. Wurdack K. J. Zimmer E. A. Weigt L. A. Janzen D. H.. 2005. Use of DNA barcodes to identify flowering plants. Proceedings of the National Academy of Sciences, USA 102: 8369-8374.[Abstract/Free Full Text]

Maggs C. A. Douglas S. E. Fenety J. Bird C. J.. 1992. A molecular and morphological analysis of the Gymnogongrus devoniensis (Rhodophyta) complex in the north Atlantic. Journal of Phycology 28: 214-232.[CrossRef][ISI]

Mallet J. Willmott K.. 2003. Taxonomy: renaissance or Tower of Babel?. Trends in Ecology and Evolution 18: 57-59.[CrossRef]

Meyer C. P. Paulay G.. 2005. DNA barocding: error rates based on comprehensive sampling. PLoS Biology 3(12): e422.

Müller K. M. Cannone J. J. Sheath R. G.. 2005. A molecular phylogenetic analysis of the Bangiales (Rhodophyta) and description of a new genus and species, Pseudobangia kaycoleia. Phycologia 44: 146-155.[CrossRef][ISI]

Nelson W. A. Farr T. J. Broom J. E. S.. 2005. Dione and Minerva, two new genera from New Zealand circumscribed for basal taxa in the Bangiales (Rhodophyta). Phycologia 44: 139-145.[CrossRef][ISI]

Provan J. Murphy S. Maggs C. A.. 2004. Universal plastid primers for Chlorophyta and Rhodophyta. European Journal of Phycology 39: 43-50.[CrossRef][ISI]

Saunders G. W.. 2005. Applying DNA barcoding to red macroalgae: a preliminary appraisal holds promise for future applications. Philosophical Transactions of the Royal Society of London, B, Biological Sciences 360: 1879-1888.[CrossRef]

Schindel D. E. Miller S. E.. 2005. DNA barcoding a useful tool for taxonomists. Nature 435: 17.[Medline]

Sneath P. H. A. Snokal R. R.. 1973. Numerical taxonomy W. H. Freeman, San Francisco, California, USA.

Steentoft M. Irvine L. M. Farnham W. F.. 1995. Two terete species of Gracilaria and Gracilariopsis (Gracilariales, Rhodophyta) in Britain. Phycologia 34: 113-127.[ISI]

Swofford D. L.. 2003. PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4.0 b10 Sinauer, Sunderland, Massachusetts, USA.

Will K. W. Mischler B. D. Wheeler Q. D.. 2005. The perils of DNA barcoding and the need for integrative taxonomy. Systematic Biology 54: 844-851.[CrossRef][Medline]

Zuccarello G. C. Schidlo N. Mcivor L. Guiry M. D.. 2005. A molecular re-examination of speciation in the intertidal red alga Mastocarpus stellatus (Gigartinales, Rhodophyta) in Europe. European Journal of Phycology 40: 337-344.[CrossRef][ISI]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Robba, L.
Right arrow Articles by Brodie, J.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Robba, L.
Right arrow Articles by Brodie, J.
Agricola
Right arrow Articles by Robba, L.
Right arrow Articles by Brodie, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS