Am. J. Bot.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Calviño, C. I.
Right arrow Articles by Downie, S. R.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Calviño, C. I.
Right arrow Articles by Downie, S. R.
Agricola
Right arrow Articles by Calviño, C. I.
Right arrow Articles by Downie, S. R.
(American Journal of Botany. 2006;93:1828-1847.)
© 2006 Botanical Society of America, Inc.


Systematics and Phytogeography

A molecular phylogenetic study of southern African Apiaceae1

Carolina I. Calviño5, Patricia M. Tilney, Ben-Erik van Wyk and Stephen R. Downie

Department of Plant Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 USA; 3Instituto de Botánica Darwinion, Buenos Aires, Argentina; and 4University of Johannesburg, Auckland Park, South Africa

Received for publication March 19, 2006. Accepted for publication October 5, 2006.

ABSTRACT

It has been suggested that southern Africa is the origin of the predominantly herbaceous Apiaceae subfamily Apioideae and that the woody habit is plesiomorphic. We expand previous molecular phylogenetic analyses of the family by considering all but three of the approximately 38 genera native to southern Africa, including all genera whose members, save one, have a woody habit. Representatives of five other genera are included because they may be closely related to these southern African taxa. Chloroplast DNA rps16 intron and/or nuclear rDNA ITS sequences for 154 accessions are analyzed using maximum parsimony, Bayesian, and maximum likelihood methods. Within Apioideae, two major clades hitherto unrecognized in the subfamily are inferred. The monogeneric Lichtensteinia clade is sister group to all other members of the subfamily, whereas the Annesorhiza clade (Annesorhiza, Chamarea, and Itasina) plus Molopospermum (and Astydamia in the ITS trees) are the successive sister group to all Apioideae except Lichtensteinia. Tribe Heteromorpheae is expanded to include Pseudocarum, "Oreofraga" ined., and five genera endemic to Madagascar. The southern African origin of subfamily Apioideae is corroborated (with subsequent migration northward into Eurasia along two dispersal routes), and the positions of the herbaceous Lichtensteinia and Annesorhiza clades within the subfamily suggest, surprisingly, that its ancestor was herbaceous, not woody.

Key Words: Apiaceae • Apioideae • cpDNA rps16 intron • phylogeny • rDNA ITS • Saniculoideae • southern Africa • woodiness

Southern Africa stands out by its great biological distinctiveness. The area customarily treated for floristic purposes as southern Africa includes Botswana, Lesotho, Namibia, South Africa, and Swaziland. The African subcontinent is remarkable for both its high plant richness and endemism at all taxonomic levels (Goldblatt, 1978 ; Goldblatt and Manning, 2002 ). It is also the origin, as well as the center of radiation, of numerous, diverse lineages of flowering plants. Approximately 53% of the total flora of the Cape region of South Africa has a shrubby habit, an overwhelming proportion even when compared with other Mediterranean floras such as those of California or Chile (Goldblatt and Manning, 2002 ). While the prevalence of woody species on oceanic islands has long attracted the attention of evolutionary biologists, less is known about the origin of the herbaceous vs. woody habit in continental floras, especially in the floristically unique southern Africa. It is often assumed that herbaceous plants within a family are derived from woody ancestors; such assumptions, however, have generally relied on implicit hypotheses of character-state polarity. It is of evolutionary interest to ascertain if the prevalence of woodiness in the southern African flora is the result of phylogenetic heritage or adaptation.

The immense phylogenetic importance of those plants native to southern Africa is exemplified by the family Apiaceae. Burtt (1991) , Van Wyk (2001) , and Van Wyk and Tilney (2004) emphasized the significance of these plants in terms of their unique morphological diversity and the difficulties in finding obvious, close relatives for many of them. Some of these genera have been postulated to be links between subfamilies Apioideae and Saniculoideae (Burtt, 1991 ); others may have evolved independently from these subfamilies (Van Wyk, 2001 ). The many unusual and defining features of these African plants include an arborescent or shrubby habit, deciduous leaves with dentate-aristate margins, and heteromorphic mericarps (Liu et al., 2003 ; Liu, 2004 ; Van Wyk and Tilney, 2004 ). Early molecular phylogenetic investigations revealed that two of these genera, Heteromorpha Cham. & Schltdl. and Anginon Raf., arborescent and shrubby plants endemic to sub-Saharan and southern Africa, either constitute a clade sister group to all other taxa of subfamily Apioideae or comprise successively basal-branching lineages within the subfamily (Downie et al., 1996 , 1998 ; Plunkett et al., 1996a , b ). The phylogenetic placements of these taxa suggested that southern Africa is the likely origin of the largely north temperate subfamily Apioideae and that the woody habit is plesiomorphic within the subfamily. Following these studies, Downie and Katz-Downie (1999) showed that the African endemic genera Anginon, Dracosciadium Hilliard & B. L. Burtt, Glia Sond., Heteromorpha, and Polemannia Eckl. & Zeyh. unite as a well-supported monophyletic group (named the Heteromorpha clade and, subsequently, tribe Heteromorpheae; Downie et al., 1998 , 2000b ). They further revealed that the woody apioid African endemic genera, Polemanniopsis B. L. Burtt and Steganotaenia Hochst., comprise a clade sister group to subfamily Saniculoideae, suggesting that this subfamily may have also evolved from woody ancestors. In the neighbor-joining and maximum likelihood trees inferred from phylogenetic analyses of chloroplast DNA (cpDNA) rps16 intron sequences, tribe Heteromorpheae is sister group to all other Apioideae (Downie and Katz-Downie, 1999 ). The strict consensus tree inferred from maximum parsimony analysis of these data, however, suggests that either tribe Heteromorpheae or the species Annesorhiza altiscapa Schltr. ex H. Wolff (or both) may be a sister group to a clade comprising the other members of subfamily Apioideae. Annesorhiza Cham. & Schltdl. is a genus of perennial herbs endemic to southern Africa, thus its position as a possible sister group to all other Apioideae is intriguing for it suggests a herbaceous ancestry for the subfamily, contrary to what has been generally assumed.

The importance of southern African Apiaceae in the early evolutionary history of the family is now well established, but knowledge of these umbellifers is limited by inadequate sampling, especially of the herbaceous African endemics. The relationships of the herbaceous taxa to the woody African genera and to the more northern herbaceous members of the family are not clear, and explicit hypotheses that include a broad representation of these woody and herbaceous African genera are lacking. Therefore, increasing the sampling of both herbaceous and woody southern African umbellifers (and including several non-African genera considered as belonging to the earliest diverging lineages of Apioideae) is critical in illuminating the direction of evolution of their unusual characters (many of which are hypothesized to be plesiomorphic within the family; Van Wyk and Tilney, 2004 ) and the historical biogeography of subfamily Apioideae.

The major objectives of this study are to (1) ascertain the phylogenetic placements of native southern African Apiaceae based on cpDNA rps16 intron and/or nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) sequences, with emphasis on those genera whose members have a woody habit; (2) corroborate a southern African origin of subfamily Apioideae, as suggested by previous molecular systematic investigations, and reconstruct its subsequent biogeographic history; and (3) test the prevailing hypothesis that the woody habit is plesiomorphic in the subfamily. Progress on reclassifying the subfamily Apioideae, as well as having a better understanding of its origin and early diversification, can only be achieved upon consideration of these extraordinary African plants.

MATERIALS AND METHODS

Taxa and outgroup selection
A total of 154 accessions was examined for cpDNA rps16 intron and/or nuclear rDNA ITS sequence variation. In the phylogenetic analysis of rps16 intron sequences, 130 accessions were considered, which included 60 genera and 116 species of Apiaceae and two genera (three species) of Araliaceae. DNA sequences from 54 of these accessions were obtained specifically for this study (Table 1); data for the remaining 76 accessions were obtained during a previous study of woody southern African taxa (Downie and Katz-Downie, 1999 ). In the ITS phylogenetic analysis, 84 accessions of Apiaceae (representing 32 genera and 66 species) were considered and of these, 58 are new (Table 1). Voucher data and GenBank accession numbers for the 26 accessions examined previously for ITS sequence variation are available elsewhere: Komarovia Korovin and Physospermum Cusson (Downie et al., 1998 ); Aulacospermum Ledeb., Eleutherospermum K. Koch, Erigenia Nutt., Hansenia Turcz., Parasilaus Leute, and Pleurospermum Hoffm. (Katz-Downie et al., 1999 ); Molopospermum W. D. J. Koch (Downie et al., 2000a ); "Oreofraga" ined., Physospermopsis H. Wolff, and Pleurospermum (Downie et al., 2000c ); Cyclorhiza M. L. Sheh & R. H. Shan, Notopterygium H. Boissieu, Tongoloa H. Wolff, and Trachydium Lindl. (Valiejo-Roman et al., 2002a ); Anginon and Bupleurum L. (Neves and Watson, 2004 ); and Haplosphaera Hand.-Mazz. and Sinolimprichtia H. Wolff (Valiejo-Roman et al., 2006 ). Sixty accessions were common to both cpDNA and ITS data sets.


View this table:
[in this window]
[in a new window]

 
Table 1. New accessions of Apiaceae from which cpDNA rps16 intron and/or nuclear rDNA ITS sequences were obtained, with corresponding DNA accession and GenBank reference numbers and voucher information. Herbarium acronyms are according to Holmgren et al. (1990) . References to previously published rps16 intron and ITS sequences are cited in the text. Accessions Chamarea gracillima 2597 and C. longipedicellata each had ITS sequence heterogeneity and were not included in the phylogenetic analysis, nor were they submitted to GenBank

 
Burtt (1991) and Van Wyk (2000) recognized 36–38 genera of Apiaceae as native to southern Africa, of which 19 are endemic to southern Africa and five are endemic to sub-Saharan Africa. We included 27 of these genera in this study, including 16 of the endemics. With the exception of the monotypic genus Marlothiella H. Wolff, which was excluded from our study because of inadequate material for DNA extraction, we considered all native African genera whose members exhibit a woody habit. Several of these genera represent shrubs or small trees (Anginon, Heteromorpha, Polemannia, Polemanniopsis, and Steganotaenia), while others comprise both subshrubs (or shrubs) and herbaceous members (Deverra DC., Diplolophium Turcz., Peucedanum L., and Stenosemis Sond.). We examined 10 of 12 species of Anginon (Allison and Van Wyk, 1997 ), five of seven species of Heteromorpha (Winter and Van Wyk, 1996 ), all three species of Polemannia (Van Wyk, 2000 ), the monotypic Polemanniopsis, and one of two species of Steganotaenia (Van Wyk, 2000 ). We also included eight endemic herbaceous genera: Annesorhiza, Chamarea Eckl. & Zeyh., Choritaenia Benth., Dasispermum Raf., Dracosciadium, Hermas L., Itasina Raf., and Lichtensteinia Cham. & Schltdl. (Burtt, 1991 ). The genus Hermas is placed in Apiaceae subfamily Hydrocotyloideae (as that subfamily is traditionally circumscribed), but shares several features typical of subfamily Saniculoideae (B. J. de Villiers et al., University of Johannesburg, unpublished data). Eight genera native to southern Africa do not occur within basal Apioideae and, thus, were omitted from the study. Their phylogenetic placements are as follows: Alepidea F. Delaroche and Arctopus L. (subfamily Saniculoideae; Plunkett and Lowry, 2001 ; C. I. Calviño and S. R. Downie, unpublished data); Agrocharis Hochst. (Scandiceae; Downie et al., 2000b ); Berula W. D. J. Koch (Oenantheae; Hardway et al., 2004 ); Pimpinella L. (Pimpinelleae; Downie et al., 2000a , 2001 ); Sonderina H. Wolff (Tordylieae; S. R. Downie, unpublished data); Stoibrax Raf. (Apium clade; K. Spalik, University of Warsaw, unpublished data); and Capnophyllum Gaertn. (apioid superclade; Downie et al., 1998 , 2001 ). In summary, of the approximately 38 genera of Apiaceae native to southern Africa, the phylogenetic placements of all but three have now been considered, either in this study or elsewhere. These exceptions include Marlothiella, Ezosciadium B. L. Burtt., and Phlyctidocarpa Cannon & W. L. Theob. Each of these genera is monotypic, with both Marlothiella and Phlyctidocarpa occurring in Namibia, and Ezosciadium restricted to the Eastern Cape of South Africa.

Representatives of five other genera were also considered, as prior studies or unpublished phylogenetic analyses suggested their close relationships to tribes Pleurospermeae or Heteromorpheae. These taxa are Molopospermum peloponnesiacum (L.) W. D. J. Koch (Downie et al., 2000a ), "Oreofraga morrisiana" ined. (Downie et al., 2000c ), Chamaesium paradoxum H. Wolff (Spalik and Downie, 2006 ), Pseudocarum C. Norman spp. (Van Wyk et al., 1999 ; Van Wyk, 2001 ), and Astydamia latifolia (L. f.) Baillon (K. Spalik, University of Warsaw, unpublished data). Molopospermum is a monotypic genus, with a limited distribution in montane and subalpine zones of the Pyrenees, Massif Central, and southern Alps; "Oreofraga morrisiana" (M. F. Watson and E. L. Barclay, Royal Botanic Garden Edinburgh, unpublished data) is a yet to be described species from Socotra; Chamaesium H. Wolff is a genus of small, montane, perennial herbs distributed from the east Himalayas to southwest China; Pseudocarum is a suffrutescent climber native to tropical east Africa and Madagascar; and Astydamia DC. is endemic to the Canary Islands. We included additional representatives of tribe Pleurospermeae, as well as Erigenia and members of the Komarovia clade, because these taxa comprise lineages adjacent to tribes Heteromorpheae and Bupleureae in previous phylogenetic analyses (Downie et al., 2001 ; Valiejo-Roman et al., 2002a ).

All trees resulting from analyses of rps16 intron sequences were rooted with Aralia L. and Hydrocotyle L. of the family Araliaceae (Chandler and Plunkett, 2004 ). As additional outgroups, we included members of Apiaceae subfamilies Azorelloideae and Mackinlayoideae (Chandler and Plunkett, 2004 ; Plunkett et al., 2004 ), primarily to help place the genus Hermas, which has been traditionally treated as a hydrocotyloid. Rooting of the ITS trees was not as straightforward because of high sequence divergence across the range of taxa considered. Among the various coding and noncoding loci utilized most commonly for Apiaceae phylogenetic study, the ITS region is the most rapidly evolving (Downie et al., 2001 ). At deep-level analyses within the family, however, its high rate of nucleotide substitution and many small insertion–deletion events (indels) make the alignments particularly problematic, confounding hypotheses of positional homology (Downie and Katz-Downie, 1996 ; Downie et al., 1998 , 2000c , 2001 ). Additionally, at this level of comparison, optimization alignment of ITS sequence data with respect to gap and mismatch weighting can result in different phylogenetic estimates (Petersen et al., 2002 ; Hardway et al., 2004 ). Pairwise sequence divergence values of between 5% and 15% among the taxa compared usually indicate an appropriate rate of divergence that will often yield readily alignable sequences (Olmstead and Palmer, 1994 ). Sequences that are substantially more divergent, particularly those with numerous indels, are difficult to align. For those regions of questionable alignment, it is best to exclude them from the analysis (Swofford and Olsen, 1990 ). The results of the rps16 intron phylogenetic analyses were used to partition the taxa sequenced for the ITS region into three data sets of supposedly related taxa so that ambiguity of alignment is reduced or avoided within each. These three ITS data sets comprised (1) tribe Heteromorpheae, with one accession of Annesorhiza (Annesorhiza clade) selected as the outgroup; (2) tribe Pleurospermeae and the Komarovia clade and its allies, with Bupleurum (tribe Bupleureae) selected as the outgroup; and (3) the Annesorhiza clade and its allies, with Lichtensteinia (Lichtensteinia clade) identified as the outgroup. Alternative selections of outgroups, such as rooting the trees of the Heteromorpheae data set with Bupleurum or Lichtensteinia or rooting the trees of the Annesorhiza clade data set with Heteromorpha, did not appreciably change the ingroup tree topologies.

Experimental strategy
Leaf material for DNA extraction was obtained directly from the field, from plants cultivated from seed in the greenhouse, from accessioned plants from botanical gardens, or from herbarium specimens. Voucher information is given in Table 1 for all newly obtained sequences. Total genomic DNA was extracted using the modified hexadecyltrimethylammonium bromide (CTAB) protocol of Doyle and Doyle (1987) as detailed in Downie and Katz-Downie (1996, 1999) or using a DNeasy Plant Mini Kit (Qiagen, Valencia, California, USA).

The region encompassing the rps16 intron and a portion of its flanking 3' exon was PCR-amplified using primer pair 5'exon-N (CGTTTGAAACGATGTGGTAG) and rps16 3'exon (CCTGTAGGYTGNGCNCCYTT) or 5'exon-C (TTTGAAACGATGTGGTAGA) and 3'exon-CR (ACCCACGTTGCGAAGAT). All primers are written 5' to 3'. The first pair is that of Downie and Katz-Downie (1999) , but primer 5'exon-N is six bases upstream from the original primer-binding site. The other primer pair was designed from a consensus sequence of previously published rps16 Apiaceae sequences to minimize self-dimer, hairpin, and pair-dimer formation. Internal primers rps16-C (TAAGAAGCACCGAAGTAATGTC) and rps16-CR (AATGGCGTTTCCTTGTTC) were designed specifically to facilitate some amplifications. PCR amplification methods are the same as described previously (Downie and Katz-Downie, 1996 , 1999 ). For template purification, the QIAquick PCR Purification or the QIAquick Gel Extraction Kits (Qiagen) were used following the manufacturer's instructions. Sequencing reactions were carried out using the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California, USA). Each of these reactions consisted of 2–5 µl purified PCR product, 5.2 µl of 12.5% glycerol, 2 µl of 5x sequencing buffer, 2 µl of 10 µM sequencing primer, 1.8 µl of sterile water, and 1 µl of Ready Reaction Mix (containing the dye terminators and AmpliTaq DNA polymerase). After an initial denaturation step of 1 min at 95°C, the following 35 thermal cycles were performed: (1) 15 s at 95°C, (2) 5 s at 45°C, and (3) 4 min at 60°C. All sequencing was done using an ABI (Applied Biosystems) 3730XL high-throughput DNA capillary sequencer at the Genetic Engineering Facility of UIUC's Biotechnology Center. The strategies employed to obtain the ITS sequence data are the same as presented elsewhere (Downie and Katz-Downie, 1996 ; Downie et al., 2000a ). With the exception of two accessions of Chamarea that had ITS sequence heterogeneity, all rps16 intron and ITS sequences acquired in this study were deposited in GenBank (Table 1).

Simultaneous consideration of both DNA strands across all sequenced regions permitted unambiguous base determination in all taxa, with two exceptions. The single accession of Chamarea longipedicellata demonstrated evidence of ITS sequence additivity at multiple nucleotide sites, as inferred by overlapping peaks on electropherograms from both forward and reverse sequencing runs. To examine the extent of sequence homogenization among reiterated ITS copies, molecular cloning of this species was conducted. Purified Taq polymerase-amplified PCR products were ligated to pCR4-TOPO plasmid vectors and subsequently transformed into chemically competent Escherichia coli cells using the TOPO TA Cloning Kit (Invitrogen, Carlsbad, California, USA) following the manufacturer's protocol. Sixty colonies were picked and cultured overnight on selective plates. Five transformed colonies were removed, boiled in 100 µl of sterile water for 15 min, then centrifuged at 4000 rpm for 5 min. To verify the presence of inserts in these transformed colonies, we made a 20-µl PCR cocktail containing 5.0 µl of supernatant, 2.0 µl of 10x Taq polymerase reaction buffer, 2 µl of 1.25 mM dNTPs, 1.2 µl of 50 mM MgCl2, 0.5 µl each of 20 µM promoter primers T7 and M13 Reverse, 1 unit of Taq polymerase, and approximately 8 µl of sterile water. After an initial denaturation step of 10 min at 95°C, the following PCR cycling program was used: (1) 45 s at 95°C, (2) 60 s at 57°C, and (3) 60 s at 72°C. A 15-min 72°C extension period followed completion of 35 thermal cycles. PCR products were examined on 1% agarose gels for the presence of inserts, and concentrations were estimated by visual comparison with bands containing known amounts of DNA. Three positive transformants were purified using the QIAprep Spin Miniprep Kit (Qiagen) and the manufacturer's instructions, then sequenced using primer T7. One accession of Chamarea gracillima (2597) also had ITS sequence heterogeneity at multiple sites, but was not cloned.

Sequence comparisons and phylogenetic analyses
The determination of boundary sequences for the six major structural domains of the cpDNA rps16 group II intron was based on similar boundary sequences inferred for tobacco, mustard, and other Apiaceae (Michel et al., 1989 ; Neuhaus et al., 1989 ; Downie and Katz-Downie, 1999 ). Both intron and ITS sequences were aligned initially using the default pairwise and multiple alignment parameters in the computer program CLUSTAL X (gap opening cost = 15.00, gap extension cost = 6.66, DNA transition weight = 0.50; Jeanmougin et al., 1998 ) and realigned manually as necessary. Gaps were positioned to minimize nucleotide mismatches. In the alignment of rps16 intron sequences, gaps of equal length in more than one sequence were coded as the same presence or absence character state if they could not be interpreted as different duplication or insertion events. Similarly located but different length indels were coded as multiple binary characters. In several regions, gap coding was particularly problematic because of poly-A's, -G's, or -T's or indirect duplications of adjacent elements in two or more taxa. These gaps were not scored and these ambiguous regions were excluded from subsequent phylogenetic analyses. In the ITS alignments, gaps were not scored as additional binary characters because very few were informative among the ingroup taxa. Uncorrected pairwise nucleotide distances were calculated by PAUP* version 4.0b10 (Swofford, 2002 ). Sequence characteristics were obtained for each of the six structural domains of the cpDNA rps16 intron, as well as from the entire intron plus the flanking 3'-exon portion. Similar data were obtained for the three ITS data matrices.

Sequence data from both loci were incomplete for several accessions, and these regions were scored as missing in the analyses. Data for three regions (of 23, 36, and 76 bp) within the Chamaesium paradoxum rps16 intron could not be obtained despite repeated efforts; moreover, the sequence data we did procure were generally of poor quality, attributable to low DNA concentration. For the two smallest of these regions, data were also unobtainable for Chamarea gracillima and Pseudocarum eminii. Several additional accessions were missing data (of 5–50 bp) from both ends of the matrix. The Choritaenia capensis rps16 intron had long stretches of sequence additivity, as inferred by overlapping peaks on the electropherograms. Re-extracting its DNA and repeating the PCR and DNA sequencing did not yield better results; thus this species was excluded from the analysis of intron sequences. In the ITS study, sequence data were unavailable in GenBank for the 5.8S rDNA region for all accessions of tribe Pleurospermeae, the Komarovia clade and its allies, and for Erigenia and "Oreofraga." This region had little to no variation in the other accessions examined; hence, these missing data did not affect the phylogenetic results. Data for the ITS-2 region could not be obtained for Glia prolifera 2511 and Pseudocarum laxiflorum 167 despite our repeated but unsuccessful attempts to PCR-amplify this region.

The rps16 intron and ITS data matrices were analyzed separately using maximum parsimony (MP) as implemented by PAUP*. For the MP analysis of rps16 intron data (with and without informative gaps scored as binary characters), 1000 heuristic searches were initiated using random addition starting trees with tree-bisection-reconnection (TBR) branch swapping and MulTrees selected, but saving no more than five trees from each search. These trees were subsequently used as starting trees for further TBR branch swapping. The maximum number of saved trees was set to 20 000 and these were permitted to swap to completion. The strict consensus of these 20 000 minimal length trees was then used as a topological constraint in another round of 1000 random addition replicate analyses but, in this case, only those trees that did not fit the constraint tree were saved. No additional trees were found at the length of the initial shortest trees, suggesting that the strict consensus tree adequately summarizes the available evidence, even though the exact number of trees at that length is not known. Bootstrap values (Felsenstein, 1985 ) were calculated from 500 000 replicate analyses using "fast" stepwise-addition of taxa; only those values compatible with the 50% majority-rule consensus tree were recorded. For each of the three ITS data sets, heuristic MP searches were replicated 1000 times with random stepwise-addition of taxa, TBR branch swapping, and saving multiple trees. Bootstrap values were calculated from 1000 replicate analyses using TBR branch swapping and simple stepwise-addition of taxa. To examine the extent of conflict between the rps16 intron and ITS data sets for a comparable set of taxa, the incongruence length difference (ILD) test of Farris et al. (1995) was implemented using the partition homogeneity test of PAUP*. This test was carried out with 1000 replicate analyses, using the heuristic search option with simple addition of taxa and TBR branch swapping. Although serious questions have been raised regarding the value of this test as a criterion for deciding whether data should be combined into a single phylogenetic analysis (e.g., Yoder et al., 2001 ; Barker and Lutzoni, 2002 ), it is still a widely used method to assess data heterogeneity and combinability. The number of additional steps required to force particular taxa into a monophyletic group was examined using the constraint option of PAUP*.

Bayesian inference of rps16 intron sequences was conducted using the program MrBayes version 3.0 (Huelsenbeck and Ronquist, 2001 ). The program was run in parallel on an IBM pSeries 690 system at the National Center for Supercomputing Applications at UIUC. Prior to analysis, the program Modeltest version 3.5 (Posada and Crandall, 1998 ) was used to select an evolutionary model of nucleotide substitution (among 56 possible models) that best fit these data, as selected by the Akaike Information Criterion estimator (Posada and Buckley, 2004 ). The settings appropriate for the best-fit TVM+G model were put into a MrBayes block in PAUP* (nst = 6; rates = gamma). The priors on state frequencies and rates and variation across sites (shape of the gamma distribution) were estimated automatically by the program. From a random starting tree, a Bayesian analysis was run for 7 million generations and the trees saved to a file every 100 generations (i.e., 70 000 trees were sampled). Sixteen simultaneous Markov chain Monte Carlo (MCMC) chains were run, and the temperature was adjusted to 0.05 in order to keep an appropriate heat range for the 16 chains. Branch lengths of the trees were saved. Variation in likelihood scores to determine apparent stationarity was examined graphically using the program Tracer version 1.2.1 (A. Rambaut and A. Drummond, University of Oxford, unpublished data). The states of the chain that were sampled before stationarity (i.e., the "burn in" of the chain) were discarded, and the posterior probability values for each bipartition of the phylogeny were determined from the remaining trees. MCMC convergence was also explored graphically using the cumulative option of the program AWTY online (Wilgenbusch et al., 2004 ), that displays posterior probabilities of splits at selected increments over a MCMC run.

The rps16 intron data set was also analyzed using the maximum likelihood method as implemented by PAUP* after the program Modeltest was used to select an appropriate model of nucleotide substitution. The results obtained were congruent to those inferred by the Bayesian analysis; hence they will not be discussed further.

Biogeographic analysis
To reconstruct the distribution of the ancestor of subfamily Apioideae, a dispersal–vicariance analysis was carried out with the program DIVA version 1.1 (Ronquist, 1996 ), using the optimize command and default option settings. We entered the following simplified, fully resolved phylogenetic tree based on the results of the rps16 intron analysis: (Azorelloideae, (Hermas clade, ((Steganotaenia & Polemanniopsis, Saniculoideae), (Lichtensteinia clade, ((Annesorhiza clade, Molopospermum), (Heteromorpheae, (Bupleureae, (Pleurospermeae, (Komarovia clade, (Oenantheae, apioid superclade and allies [the latter representing tribes Scandiceae, Aciphylleae and Smyrnieae])))))))))). With the exceptions of the Annesorhiza, Lichtensteinia and Hermas clades, which are newly recognized in this study, this tree is also congruent with a summary of relationships within subfamily Apioideae as revealed by phylogenetic analyses of seven molecular data sets (Downie et al., 2001 ). Because one of our primary goals was to corroborate a southern African origin of subfamily Apioideae, only three unit areas were defined: (a) southern Africa (i.e., Botswana, Lesotho, Namibia, South Africa, and Swaziland), (b) rest of the world, and (c) sub-Saharan Africa (excluding southern Africa). We coded each terminal taxon for its likely ancestral distribution and not for all of the regions in which its members presently occur, because if we had, information important for the optimization of ancestral states would be lost (Ronquist, 1996 ). In most cases, however, ascertaining the ancestral distribution of a terminal taxon was clear, because it was endemic to one of the defined unit areas. The likely ancestral distribution of the widespread tribe Bupleureae was determined based on a recent phylogenetic study by Neves and Watson (2004) , in which a Eurasian (specifically, a western Mediterranean) origin for the group was inferred. Members of tribe Heteromorpheae are distributed primarily in southern Africa, but some genera (i.e., Heteromorpha, Pseudocarum, and "Oreofraga") also extend northward to Ethiopia and Yemen (including Socotra) (Winter and Van Wyk, 1996 ; Van Wyk et al., 1999 ). Given these distributions and in an effort to determine how each ancestral area affected the reconstruction of the distribution of the ancestor of Apioideae, we ran three different analyses assuming that the ancestor of tribe Heteromorpheae was distributed only in southern Africa, only in sub-Saharan Africa, or in both places.

Evaluating the distribution of the woody habit
Within the independent context of the phylogenies inferred from MP analysis of rps16 intron sequences, the evolutionary pattern of woodiness was hypothesized within subfamily Apioideae. The character habit, scored as herbaceous or woody for each terminal and designated as unordered, was optimized onto all minimal length trees. The "State Changes & Stasis" chart of MacClade version 4.07 (Maddison and Maddison, 2005 ) was used to determine the minimal number of times the woody habit had evolved. These reconstructions of character evolution were displayed graphically using the option "Trace Character" in MacClade's tree window.

RESULTS

Comparisons and phylogenetic analyses of cpDNA rps16 intron sequences
Among the 130 sequences obtained, the rps16 intron varied in length from 758 (Diplolophium somaliense) to 908 bp (Annesorhiza altiscapa) and averaged 862 bp. Juxtaposed was an additional 17 bp of sequence data from the rps16 3'exon that were retained in the analysis because they contained phylogenetic information. Alignment of these intron and flanking exon sequences resulted in a matrix of 1332 positions, of which 278 were excluded from subsequent analyses because of alignment ambiguities. These ambiguous regions ranged from 1 to 43 bp in size. Of the remaining 1054 unambiguously aligned positions, 607 were not variable, 135 were variable but uninformative, and 312 were parsimony informative. Percentage G + C content for the intron ranged from 31.3 to 37.3%, averaging 34.3%. The g1 statistic for 10 000 random trees was –0.354. This value is significantly more skewed (i.e., more negative) than random data (g1 = –0.09 for 250 variable positions for more than 25 taxa; P < 0.01), indicating that these sequence data contain significant amounts of phylogenetic signal (Hillis and Huelsenbeck, 1992 ). A total of 125 unambiguous gaps, ranging between 1 and 126 bp, was required for proper alignment of these sequences; 61 gaps of 1–22 bp in size were parsimony informative. The frequency distribution of both informative and uninformative gaps in relation to their sizes is presented in Fig. 1. Relative to the outgroup Aralia chinensis L., these gaps represent a minimum of 84 insertion and 39 deletion events (two gaps could not be polarized because they were unique to Aralia). Pairwise sequence divergence estimates ranged from identity to 13.3% of nucleotides [the latter between Hydrocotyle rotundifolia Wall. and Torilis arvensis (Huds.) Link]. Each of the following groups of taxa yielded identical DNA sequences: two species of Bupleurum (B. chinense and B. americanum); three species of Eryngium L. (E. alternatum J. M. Coult. & Rose, E. mexiae Constance, and E. yuccifolium Michx.); four accessions of Anginon (A. difforme 2455, A. fruticosum 2583, 2610, and A. swellendamense 2463); two accessions of Heteromorpha arborescens var. arborescens (42, 2631); nine accessions of Anginon, Glia, and Polemannia (A. difforme 2582, A. intermedium, A. paniculatum, A. pumilum 2606, A. rugosum 513, 2607, A. verticillatum 2608, G. prolifera 1308, and P. grossularifolia); two accessions of Annesorhiza macrocarpa (2454, 2796); and the accessions Annesorhiza filicaulis and Chamarea snijmaniae.


Figure 1
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 1. Frequency of unambiguous gaps in relation to gap size inferred in the alignment of 130 cpDNA rps16 intron and partial flanking 3'-exon sequences from Apiaceae and Araliaceae. Each bar represents the total number of parsimony informative (solid) and/or uninformative (shaded) gaps, with no overlap between them when they co-occur at the same size interval. Sixty-one gaps, of 1–22 bp in size, were parsimony informative; 64 gaps, of 1–126 bp in size, were uninformative

 
For each of the six major structural domains of the cpDNA rps16 group II intron, the characteristics of the aligned sequences are presented in Table 2. Domain I is the largest, ranging between 466 and 517 bp in size, whereas domains V (34–36 bp) and VI (21–38 bp, excluding Peucedanum pearsonii) are the smallest. Domains V and VI are also the most conserved evolutionarily, with few informative positions, low sequence divergence, and very few alignment gaps. The small size of the intron in Diplolophium somaliense is due to a 126-bp deletion, representing the almost complete removal of domain IV. The large size of the intron in Annesorhiza altiscapa is due to a 33-bp direct repeat in domain I, but in only one of two accessions of this species. In Peucedanum pearsonii, domain VI is 79 bp in size, resulting from the direct repetition of 44 bp of adjacent sequence, some of which is from domain V.


View this table:
[in this window]
[in a new window]

 
Table 2. Sequence characteristics of the six major structural domains of the cpDNA group II rps16 intron for 130 accessions of Apiaceae and Araliaceae

 
MP analysis of 1054 unambiguously aligned rps16 intron and flanking exon nucleotide positions plus 61 binary-scored informative gaps resulted in the preset maximum tree limit of 20 000 trees, each of 1148 steps (CIs = 0.6028 and 0.5366, with and without uninformative characters, respectively; RI = 0.8820). The strict consensus of these trees (with accompanying bootstrap values) is shown in Fig. 2. Repeating the analysis without the 61 scored gaps also resulted in the preset limit of 20 000 trees, each of 1060 steps (CIs = 0.5953 and 0.5212, with and without uninformative characters, respectively; RI = 0.8760). The topology of this strict consensus tree was identical to that when the gaps were included, with the following exceptions: Crithmum maritimum L. comprises a clade with Aegokeras caespitosa (Sibth. & Sm.) Raf. and Chamaesciadium acaule; the two accessions of Deverra form a clade with Apium graveolens L. and Petroselinum crispum (Mill.) A. W. Hill; the branch leading to Erigenia bulbosa (Michx.) Nutt. collapses; less resolution is obtained within Heteromorpha, Polemannia, and Anginon, as well as within Annesorhiza and Chamarea; and Hermas is resolved as sister taxon to the major clade of Steganotaenia/Polemanniopsis, Saniculoideae and Apioideae. Overall, the inclusion of gap characters in the analysis increased resolution in some portions of the tree (particularly within Heteromorpha, Anginon, Annesorhiza, and Chamarea), but also decreased it in other portions of the tree (i.e., the phylogenetic position of Hermas).


Figure 2
View larger version (42K):
[in this window]
[in a new window]

 
Fig. 2. Strict consensus of 20 000 minimal length 1148-step trees derived from equally weighted maximum parsimony analysis of 130 cpDNA rps16 intron and partial flanking 3'-exon sequences plus 61 binary-scored alignment gaps (CIs = 0.6028 and 0.5366, with and without uninformative characters, respectively; RI = 0.8820). Numbers at nodes are bootstrap estimates for 500 000 replicate analyses using "fast" stepwise-addition of taxa; values <50% are not indicated. The names of the major clades are based on previous studies or are newly recognized in this study

 
In the Bayesian analysis, the trace plot calculated by the program Tracer showed two apparent stationarity phases, as inferred by a bimodal distribution of the likelihood values: one between generations 90 000 and 1 340 000; the other, with slightly higher likelihood values, beginning from about the 1 968 000th generation. The cumulative graphic produced by the program AWTY online showed that the posterior probabilities of the splits during the first apparent stationarity period are not stabilized, meaning that the MCMC analysis had not converged onto the stationarity distribution during this period. On the contrary, the posteriors do stabilize during the second phase, showing that tree topologies are finally being sampled in proportion to their posterior distribution and that the chains actually reached stationarity by the 1 968 000th generation. Given these results, the first 19 680 trees were discarded as the "burn in" and a 50% majority-rule consensus tree was calculated based upon the remaining 50 320 trees (Fig. 3). The consensus tree from the first stationarity period showed almost the same topology as the one based on the second stationarity period. The only difference between them was found within Saniculoideae. Eryngium formed a monophyletic group in the first stationarity period while this alliance collapsed in subsequent generations.


Figure 3
View larger version (43K):
[in this window]
[in a new window]

 
Fig. 3. Fifty-percent majority-rule consensus of 50 320 trees derived from Bayesian analysis of 130 cpDNA rps16 intron and partial flanking 3'-exon sequences. Numbers at nodes are posterior probability values. The names of the major clades are based on previous studies or are newly recognized in this study

 
The phylogenies estimated using MP, Bayesian, and maximum likelihood analyses of rps16 intron sequences are highly consistent with one another. Twenty-two major tribes and clades identified in previous studies (Downie et al., 2001 ; Plunkett et al., 2004 ), as well as in this study, are bracketed in Figs. 2 and 3. These include Apioideae, the apioid superclade (comprising tribes Careae, Pyramidoptereae, and Selineae, and the Apium and Heracleum clades), Scandiceae, Aciphylleae, Smyrnieae, Oenantheae, the Komarovia clade, Pleurospermeae (constituting two unresolved lineages in these trees, but monophyletic in previous studies), Bupleureae, Heteromorpheae, Annesorhiza clade, Lichtensteinia clade, Saniculoideae, Steganotaenia + Polemanniopsis, Hermas clade, Azorelloideae, Mackinlayoideae, and the outgroup Araliaceae. Many of these clades are well supported, with high bootstrap and posterior probability values. The Annesorhiza, Lichtensteinia, and Hermas clades are newly recognized. The Annesorhiza clade comprises Annesorhiza, Chamarea, and Itasina. Within this clade, pairwise sequence divergence estimates across the three genera range from identity to 1.7%. The Lichtensteinia clade is monogeneric. The Annesorhiza and Lichtensteinia clades are successively basal to tribe Heteromorpheae and represent the earliest known branching lineages within subfamily Apioideae. The Hermas clade is also monogeneric and, in the Bayesian tree and the MP strict consensus tree without scored gap characters, arises as a weakly supported sister group to a clade comprised of Saniculoideae, Steganotaenia/Polemanniopsis, and Apioideae.

The phylogenies inferred from rps16 intron sequence data help to clarify the phylogenetic placements of several taxa. Pseudocarum spp. allies with Dracosciadium, which is included along with Anginon, Glia, Heteromorpha, and Polemannia in tribe Heteromorpheae. Molopospermum is sister group to the Annesorhiza clade, but this relationship is not very strongly supported (59% bootstrap, 56% posterior probability). The five shrubby and endemic South African species of Peucedanum are closely related, with 0.1–1% pairwise sequence divergence among them, and in the Bayesian tree they form a clade with the South African genus Dasispermum. Chamaesciadium acaule, from the Caucasus, allies strongly with Aegokeras caespitosa from Turkey (95% bootstrap, 100% posterior probability) and is a new addition to tribe Careae. Deverra occurs in the Apium clade of the apioid superclade. The genera Steganotaenia and Polemanniopsis, treated traditionally in subfamily Apioideae, unite as a well-supported clade that is sister group to subfamily Saniculoideae. This sister group relationship, however, is supported weakly, with 58% and 87% bootstrap and posterior probability values, respectively. Constraining Steganotaenia, Polemanniopsis, and all accessions of subfamily Apioideae to monophyly in a subsequent MP search resulted in trees just one step longer than those without the constraint. In these suboptimal trees, Steganotaenia/Polemanniopsis is sister group to the clade comprised of Heracleum through Lichtensteinia.

The phylogenetic position of Chamaesium paradoxum remains unclear. Sequence data were only available for about 80% of its intron and much of it was of poor quality. The results of an initial MP analysis placed C. paradoxum on one branch of a four-branched polytomy in a strict consensus tree, along with tribe Heteromorpheae, the Annesorhiza clade plus Molopospermum, and the large, distal clade comprised of Heracleum through Bupleurum. In the majority-rule consensus tree, C. paradoxum is sister group to the Heracleum through Bupleurum clade. While these results indicate that Chamaesium paradoxum has allies among the basal apioids, its phylogenetic position is far from certain. Moreover, the poor quality of these data precluded their consideration in the final analysis of rps16 intron sequences.

Nuclear rDNA ITS sequence comparisons and phylogenetic analyses
Chamarea longipedicellata and one accession of C. gracillima (2597) demonstrated evidence of ITS sequence additivity at multiple nucleotide sites. Molecular cloning of the single accession of Chamarea longipedicellata revealed intra-individual ITS polymorphisms. Three sequence types were identified from the ITS-1 region, differing from each other by 7–18 nucleotide substitutions. Gene trees inferred by combining these three sequences with data obtained from direct sequencing of PCR products from other members of the Annesorhiza clade revealed the two most similar clones of C. longipedicellata comprising a clade with C. snijmaniae, a result in accordance with that inferred by phylogenetic analysis of rps16 intron sequences. The third clone allied with the two accessions of Annesorhiza altiscapa, differing from them by four nucleotide substitutions. These intra-individual paralogous ITS sequences plus the sequences obtained from direct sequencing of C. longipedicellata and C. gracillima (2597) were not included in subsequent analyses because they would mislead phylogenetic inferences.

Details of the alignments of the three ITS data sets of putatively related taxa are presented in Table 3. For each matrix, less than 11% of all positions were excluded because of alignment ambiguities. The first matrix comprised members previously attributable to tribe Heteromorpheae and, as a result of the rps16 intron analyses, two species of Pseudocarum. We also included the genus "Oreofraga" based on sequence similarity. When compared with any other member of this group, "Oreofraga" has a sequence divergence value of between 7.4% and 12.9% and is readily aligned. The second matrix included Erigenia bulbosa and those accessions of tribe Pleurospermeae and the Komarovia clade currently available in GenBank. We also included several Sino-Himalayan and other Asian species of Apioideae having a close affinity to taxa of the Komarovia clade (Valiejo-Roman et al., 2002a ). Diplolophium somaliense was included in this group, because it fell between the aforementioned clades in the rps16 intron trees, and so was Chamaesium paradoxum, because a possible affinity to tribes Bupleureae and Heteromorpheae was established in the rps16 intron analysis. Pairwise divergence estimates between C. paradoxum and the outgroup Bupleurum ranged from 5.8 to 7.5%; when C. paradoxum was compared to any other member of this matrix, divergence values ranged from 20.8 to 27.2%. Sequence divergence estimates between any ingroup member (other than C. paradoxum) and Bupleurum were high, with values ranging from 27.2 to 34.9%. A close relationship between C. paradoxum and Annesorhiza was also established in the intron analysis, but aligning C. paradoxum with any member of the Annesorhiza clade proved difficult, resulting in several long, ambiguously aligned regions. We acknowledge that the phylogenetic placement of C. paradoxum is unclear and that its inclusion in the second matrix is simply based on the similarity of its ITS sequence with those of Bupleurum. The third matrix included all representatives of the Annesorhiza clade plus Molopospermum, Astydamia, and Choritaenia. Molopospermum is a weakly supported sister taxon to the Annesorhiza clade in the rps16 intron trees, and the Astydamia ITS sequence was similar to those of Annesorhiza, Chamarea, and Molopospermum, with up to 11.4% maximum nucleotide divergence in pairwise comparisons. Across all ITS sequences, Choritaenia was most similar to others of this group; here, pairwise comparisons ranged from 14.3–18.6% (the latter between Choritaenia and Molopospermum).


View this table:
[in this window]
[in a new window]

 
Table 3. Sequence characteristics of the three nuclear rDNA ITS data sets (A, tribe Heteromorpheae; B, tribes Pleurospermeae and Erigenieae and the Komarovia and Physospermopsis clades; C, Annesorhiza clade plus allies)

 
The strict consensus trees resulting from MP analyses of the three ITS data sets are presented in Fig. 4. The results of the first analysis (Fig. 4A) indicate that Glia prolifera arises from within a paraphyletic Anginon and that Heteromorpha and Polemannia are each monophyletic. "Oreofraga" is placed within a paraphyletic Pseudocarum, and this clade is sister group (albeit with weak branch support) to Dracosciadium. The results of the second analysis (Fig. 4B) maintain tribe Pleurospermeae (Aulacospermum, Eleutherospermum, Physospermum, and Pleurospermum) as monophyletic (100% bootstrap). The Chinese genera Physospermopsis, Trachydium, Tongoloa, Sinolimprichtia, Notopterygium, and Haplosphaera unite with north and central Asian Hansenia in a clade (66% bootstrap), a group we refer to provisionally as the Physospermopsis clade. This clade is a weakly supported sister group to a redefined Komarovia clade (i.e., Komarovia, Parasilaus, and Cyclorhiza). The Physospermopsis and Komarovia clades comprise a sister group to the North American endemic species Erigenia bulbosa. Diplolophium and Chamaesium arise as successively basal sister groups to all aforementioned clades. The results of phylogenetic analysis of the third data set (Fig. 4C) reveal that the genera Annesorhiza, Chamarea, and Itasina form a strongly supported clade (98% bootstrap). Pairwise sequence divergence values across these three genera range from identity to 5.2% of nucleotides. Neither Annesorhiza nor Chamarea are monophyletic. Annesorhiza filicaulis allies weakly with Itasina filifolia. Molopospermum is sister group to Astydamia (88% bootstrap). Lichtensteinia is monophyletic, and Choritaenia capensis is a weakly supported sister group to all other taxa except for the outgroup Lichtensteinia.


Figure 4
View larger version (71K):
[in this window]
[in a new window]

 
Fig. 4. Strict consensus trees derived from MP analyses of nuclear rDNA ITS sequences of partitioned taxa: Tree A, tribe Heteromorpheae (no. of MP trees = 4; length of MP trees = 203 steps; CI without uninformative characters = 0.7438; RI = 0.9034); tree B, tribes Pleurospermeae and Erigenieae and the Komarovia and Physospermopsis clades (no. of MP trees = 9; length of MP trees = 661 steps; CI without uninformative characters = 0.5584; RI = 0.7372); tree C, Annesorhiza clade plus allies (no. of MP trees = 3; length of MP trees = 329 steps; CI without uninformative characters = 0.6752; RI = 0.7778). Bootstrap values are indicated on branches and were calculated from 1000 replicate analyses. The taxa for which ITS sequences were obtained in this investigation can be identified by their corresponding DNA accession numbers; those without numbers were obtained directly from GenBank. Complete taxon names, including the ranks of infraspecific taxa, are in Table 1

 
Comparison of rps16 intron and ITS phylogenies
In the plastid-derived trees, resolution of relationships within tribe Heteromorpheae is poor and internal branch support is weak, as a result of too few informative characters. These trees reveal that the genus Heteromorpha is not monophyletic, with the two accessions of H. arborescens var. arborescens comprising a clade with Polemannia in the MP strict consensus tree (Fig. 2) or forming a separate lineage in the Bayesian tree off a large polytomy with Anginon, Glia, and Polemannia (Fig. 3). All other accessions of Heteromorpha comprise a well-supported monophyletic group. Heteromorpha is supported as monophyletic, however, in trees just three steps longer than those most parsimonious; thus its monophyly cannot be excluded fully based on these plastid data. Accordingly, the results of the ITS analysis (Fig. 4A) support the monophyly of Heteromorpha (92% bootstrap), as well as that of Anginon (including Glia; with 83% bootstrap) and Polemannia (100% bootstrap). The results of a partition homogeneity test for those 31 accessions of tribe Heteromorpheae common to both rps16 intron and ITS data sets revealed that these two loci do not yield significantly different phylogenetic estimates (ILD probability value = 0.201) and, thus, can be combined for a "total evidence" analysis. MP analysis of combined plastid and nuclear data (using Annesorhiza macrocarpa 2454 to root the trees) revealed a strict consensus tree (not shown) with a topology similar to that represented by ITS data alone (Fig. 4A), with the exception that the two accessions of Heteromorpha arborescens var. arborescens are now a sister group to a clade comprising their congeners (no. of MP trees = 10; length = 265 steps; CI = 0.6953, excluding uninformative characters; RI = 0.8704). The combined analysis supports strongly (96% bootstrap) the monophyly of Heteromorpha.

In the rps16 intron trees (Figs. 2 and 3), members of the Annesorhiza clade comprise a polytomy, with its largest resolved branches intermixing accessions of Annesorhiza and Chamarea. Annesorhiza filicaulis and Chamarea snijmaniae possess identical rps16 intron sequences and are sister species; this clade is sister group to C. longipedicellata. A similar scrambling of taxa occurs in the ITS strict consensus tree (Fig. 4C), but with Annesorhiza filicaulis now a weakly supported sister group to Itasina filifolia. Chamarea snijmaniae unites with three other Chamarea species in a strongly supported clade and not with A. filicaulis, as it does in the rps16 intron tree. Results of a partition homogeneity test on a set of 17 accessions common to both data sets (i.e., 12 members of the Annesorhiza clade, Molopospermum, and four accessions of Lichtensteinia) revealed that these matrices yield significantly different phylogenetic estimates (ILD probability value = 0.001). As a result of this significant discordance between data sets, these data were not combined for simultaneous analysis. Otherwise, reduced or erroneous resolution with respect to the true organismal phylogeny would result without further evaluation of the source of conflict.

Biogeographic analyses
The results of the three dispersal–vicariance analyses, assuming that the ancestor of tribe Heteromorpheae was distributed only in southern Africa, only in sub-Saharan Africa, or in both places (Fig. 5A–C, respectively), indicated that the likely ancestral distribution of subfamily Apioideae was in southern Africa. Two alternative biogeographic scenarios were obtained for its distribution, however. One scenario is that the ancestor of Apioideae was strictly distributed in southern Africa. The other scenario, suggesting a "rest of the world" distribution including southern Africa, was recovered as one of two alternatives when the ancestor of Heteromorpheae was inferred to have a strictly sub-Saharan African distribution (Fig. 5B). While we defined the unit area as "rest of the world," the distribution of taxa comprising tribes Bupleureae and Pleurospermeae and the Komarovia clade is largely Eurasian. In all analyses, the biogeographical reconstructions of the ancestor of Apioideae to the ancestor of the clade comprising the Apium superclade and allies through Bupleurum vary depending on the likely distribution of the ancestor of Heteromorpheae. Each reconstruction, however, postulates a migration north to Eurasia that would have required 2–3 dispersal events.


Figure 5
View larger version (28K):
[in this window]
[in a new window]

 
Fig. 5. Optimal reconstructions of the ancestral distributions of Apioideae using dispersal–vicariance analysis assuming that the ancestor of Heteromorpheae was distributed in (A) southern Africa only, (B) sub-Saharan Africa only, or (C) both places. At each node, the optimal distribution prior to vicariance is given; alternative and equally optimal distributions are separated with a space. The historical biogeography of the deepest splits within Apioideae was analyzed in terms of three main areas: southern Africa ("a" and solid bars); rest of the world ("b" and open bars); and sub-Saharan Africa ("c" and striped bars). An asterisk indicates the origin of subfamily Apioideae. Arrows represent dispersal events for one alternative reconstruction in each tree. Dispersal events are not indicated in Fig. 5B because of the complexity of the different scenarios

 
Evolution of the woody habit
Optimization of the character habit onto all 20 000 minimal length rps16 intron trees showed that a herbaceous habit is ancestral in Apioideae and that woodiness has evolved a minimum of four times within the family. The woody habit has evolved independently in tribe Heteromorpheae, the Steganotaenia/Polemanniopsis clade, Bupleurum fruticosum L. (Bupleureae), and in Peucedanum of South Africa. The ancestor of tribe Heteromorpheae is equally parsimoniously reconstructed for both character states. Diplolophium, Deverra, and Stenosemis are described as both herbaceous and shrubby; when these taxa are scored as woody in the optimizations, the minimum number of times this habit evolved independently increased to seven. Because a completed heuristic search of these data was not possible and not all genera/species with a woody habit were included in this investigation, a precise estimate of the number of times woodiness has evolved in the subfamily cannot be made. Nevertheless, the character is clearly homoplastic within Apioideae, with numerous derivations of woodiness occurring during the evolution of the group.

DISCUSSION

Subfamilies of Apiaceae and their relationships
Four subfamilies are currently recognized in Apiaceae: Apioideae, Saniculoideae, Azorelloideae (= Azorella clade of Downie et al., 2000b , 2001 ), and Mackinlayoideae (Plunkett et al., 2004 ). Apioideae and the clade of Saniculoideae plus Steganotaenia/Polemanniopsis comprise monophyletic sister groups, with subfamilies Azorelloideae (Azorella Lam., Bolax Comm. ex Juss., and Eremocharis Phil.) and Mackinlayoideae (Centella L. and Xanthosia Rudge) comprising successively more basal branching lineages. The traditionally recognized subfamily Hydrocotyloideae (sensu Drude, 1898 ) is polyphyletic, with some of its members occurring within Apiaceae subfamilies Azorelloideae and Mackinlayoideae, and others (such as Hydrocotyle) now included within Araliaceae (Chandler and Plunkett, 2004 ). The hydrocotyloid genus Klotzschia Cham., forming an isolated lineage in the rps16 intron trees, has been provisionally included in subfamily Azorelloideae (Downie et al., 2001 ; Plunkett et al., 2004 ). However, because of its distinctive fruits (Liu, 2004 ) and its consistent occurrence as a separate lineage in all studies where it is included, Klotzschia may very well comprise a monogeneric subfamily, pending examination of its type species K. brasiliensis Cham. & Schltdl. The four included accessions of Hermas, a genus endemic to the fynbos region of South Africa and heretofore not included in any molecular systematic study, form a strongly supported clade (100% bootstrap and posterior probability). In the Bayesian tree (Fig. 3) and the MP strict consensus tree without scored gap characters (not shown), the Hermas clade arises as a weakly supported sister group to Apioideae plus the clade of Saniculoideae and Steganotaenia/Polemanniopsis. When gaps are included (Fig. 2), the relationships among many of the basal branching lineages of Apiaceae are unresolved. Hermas is traditionally placed in the subfamily Hydrocotyloideae but presents several features, such as multiflowered congested umbels and a haploid chromosome number of seven that have been interpreted as characteristic of subfamily Saniculoideae (B. J. de Villiers et al., University of Johannesburg, unpublished data). Further studies of the polyphyletic subfamily Hydrocotyloideae are in order, especially to confirm the phylogenetic placements of Klotzschia and Hermas. The results obtained to date, however, are compelling in suggesting that upon further investigation, these genera may be treated as new subfamilies of Apiaceae or constitute members of an expanded subfamily Azorelloideae.

Steganotaenia and Polemanniopsis
Our results continue to support the earlier finding that Steganotaenia and the monotypic Polemanniopsis, arborescent and shrubby plants that were treated previously in subfamily Apioideae (e.g., Pimenov and Leonov, 1993 ), unite as a well-supported clade (85% bootstrap, 100% posterior probability) sister group to subfamily Saniculoideae (Downie and Katz-Downie, 1999 ). Each of the new accessions of Steganotaenia and Polemanniopsis examined yielded almost identical rps16 intron sequences to their previously sequenced congeners. Additional synapomorphies supporting the union between Steganotaenia and Polemanniopsis include the presence of large, distinct marginal fruit wings with enormous intrajugal cavities (Liu et al., 2003 ). Subfamily Saniculoideae (represented here by Astrantia L., Eryngium, Hacquetia Neck. ex DC., Petagnaea Caruel, and Sanicula L., and by Actinolema Fenzl, Alepidea, and Arctopus in other studies [Plunkett and Lowry, 2001 ; Valiejo-Roman et al., 2002b ; C. I. Calviño and S. R. Downie, unpublished data]) forms a strongly supported clade on the basis of molecular evidence (100% bootstrap and posterior probability). The monophyly of Saniculoideae is supported by numerous morphological features (Drude, 1898 ; Van Wyk, 2001 ; Liu et al., 2003 ). The placement of Steganotaenia and Polemanniopsis into an expanded Saniculoideae, as suggested by Downie and Katz-Downie (1999) and implemented by Liu et al. (2003) , cannot easily be reconciled on the basis of morphological data, nor does it receive strong support from the molecular analyses presented herein. While these taxa share the complete absence of commissural and vallecular vittae (oil ducts in the commissure and furrows, respectively), these vittae are also absent in Lichtensteinia and many hydrocotyloids. We are not aware of any morphological synapomorphy supporting the union of Steganotaenia/Polemanniopsis with Saniculoideae that does not also include Lichtensteinia and members of subfamilies Azorelloideae and Mackinlayoideae. The only evidence clearly justifying the union of Steganotaenia and Polemanniopsis with Saniculoideae is that of the rps16 intron; this relationship, however, is only supported weakly, with 58% bootstrap and 87% posterior probability values. Moreover, a close relationship to subfamily Apioideae cannot be completely ruled out, for Steganotaenia/Polemanniopsis and Apioideae are monophyletic in trees just one step longer than those maximally parsimonious. Further molecular systematic studies on Steganotaenia/Polemanniopsis are in progress, and the results should illuminate the proper phylogenetic position of these taxa (C. I. Calviño and S. R. Downie, unpublished data).

Lichtensteinia
The five accessions of Lichtensteinia comprise a strongly supported monophyletic group in the rps16 intron trees (94% bootstrap, 100% posterior probability). We recognize this group as the Lichtensteinia clade. The affinity of Lichtensteinia has long been problematic because it shares features common to both subfamilies Saniculoideae and Apioideae (Burtt, 1991 ; Van Wyk, 2001 ). Emphasizing its large compound umbels and compound leaves, the genus was placed in Apioideae (Drude, 1898 ; Wolff, 1910 ; Pimenov and Leonov, 1993 ). By focusing attention on its fruits instead, the genus was included in Saniculoideae (Koso-Poljansky, 1916 ; Liu et al., 2003 ). The fruits of Lichtensteinia are characterized by prominent intrajugal vittae (oil ducts in the ribs) and the absence of commissural and vallecular vittae. These same features also occur in subfamily Saniculoideae, the genera Steganotaenia and Polemanniopsis, and in the hydrocotyloid lineages (Wolff, 1913 ; Tseng, 1967 ; Liu et al., 2003 ). In contrast, almost all other genera in Apioideae have large commissural and vallecular vittae and only some have small intrajugal secretory ducts (Drude, 1898 ; Liu et al., 2003 ). The presence of large intrajugal secretary ducts and the lack of both commissural and vallecular vittae among basal members of Apiaceae represent plesiomorphic character states, and the inclusion of Lichtensteinia, Steganotaenia and Polemanniopsis within an expanded subfamily Saniculoideae, as suggested by Liu et al. (2003) , is based on these symplesiomorphies. Further studies are necessary to corroborate the results obtained here, in which Lichtensteinia is sister group to a clade comprising all other taxa of subfamily Apioideae. If this relationship is maintained, a new monotypic tribe of Apioideae will be warranted. Such confirmation of the phylogenetic position of Lichtensteinia is also important to enable hypotheses on character state evolution within the subfamily.

Annesorhiza clade
The Annesorhiza clade includes Annesorhiza, Chamarea, and Itasina and is well supported in analyses of both chloroplast and nuclear DNA sequences (98–100% bootstrap, 100% posterior probability). These genera are deciduous, perennial herbs endemic to southern Africa. Annesorhiza and Chamarea have been treated previously as sister taxa (Tilney and Van Wyk, 2001 ); they are highly similar morphologically, sharing features such as expanded and lignified vascular bundles in the fruit walls, hysteranthous leaves (i.e., leaves that are formed only after flowering and fruiting), heteromorphic fruits in some species, and fleshy pencil-like or tuberous roots that are replaced periodically (Van Wyk and Tilney, 1994 ; Tilney and Van Wyk, 2001 ; Liu, 2004 ). Annesorhiza and Chamarea differ in their overall size and the shape and relative length of their fruits, with Annesorhiza usually having larger leaves, taller scapes, and oblong-shaped fruits slightly longer than the rounded or flask-shaped fruits typical of Chamarea (Tilney and Van Wyk, 2001 ). In practice, however, these characters overlap, and the boundaries between these genera are unsatisfactory. Cladistic analysis of 29 anatomical and morphological characters from leaves, fruits, and roots revealed that the concept of Annesorhiza should be broadened to include all known species of Annesorhiza and Chamarea (Vessio, 2001 ). This finding is supported by molecular evidence in which these two genera do not comprise monophyletic sister groups. Instead, the three major clades resolved in the ITS strict consensus tree (Fig. 4C) correspond to the three sections of Annesorhiza recognized by Vessio (2001) , with the only difference being the inclusion of Chamarea sp. nov. 2594 (=Annesorhiza elsiae Vessio, Tilney & B-E. van Wyk) alongside members of sect. Annesorhiza in our study rather than with A. filicaulis in sect. Ternata in the treatment by Vessio (2001) .

Annesorhiza filicaulis was recently transferred into Peucedanum (as Peucedanum filicaule (Eckl. & Zeyh.) Van Wyk and Tilney) because its fruits have a wing configuration quite unlike that of any other species of Annesorhiza (Van Wyk and Tilney, 2001 ). In Annesorhiza, the four commissural ribs are somewhat larger than the other ribs, and this asymmetrical development is taken to an extreme in A. filicaulis in which they are expanded to form large wings, such as those typical of the genus Peucedanum (Tilney and Van Wyk, 2001 ; Van Wyk and Tilney, 2001 ). This transfer, however, was done so with some uncertainty, for its retention in Peucedanum would depend ultimately upon a revision of Peucedanum and related genera in southern Africa and elsewhere (Van Wyk and Tilney, 2001 ). The cpDNA-derived phylogenies show that A. filicaulis is sister group to Chamarea snijmaniae, with this clade in turn sister group to C. longipedicellata. These same trees also indicate that A. filicaulis is quite distantly related to the five South African accessions currently treated in Peucedanum, suggesting that the transfer of A. filicaulis into Peucedanum was premature. Vessio (2001) concurred that A. filicaulis should be maintained alongside Annesorhiza and Chamarea in an expanded Annesorhiza.

The relationship between Annesorhiza (12 species; Tilney and Van Wyk, 2001 ) and Chamarea (5 species; Van Wyk, 2000 ) is complex. Considering their similar morphologies and the significant discordance between the plastid- and nuclear-derived data sets, past hybridization/introgression or polyploidization seems possible, and further study of these taxa is warranted. Other than a chromosome count of N = 12 for A. macrocarpa (Burtt, 1991 ), the chromosome numbers are not known for any other member of the Annesorhiza clade, and they would be important to know to confirm polyploidy, if it exists. The presence of additive patterns of bands in the ITS electropherograms of two species of Chamarea may be associated with allopolyploidy and would be consistent with the retention of multiple rDNA loci from different parental ancestors at the time of speciation (Soltis et al., 1992 ). Although no interspecific hybridization has been reported for the largely sympatric Annesorhiza and Chamarea, hypotheses of relationships based on morphology show considerable incongruence in the data, with many species not very well separated (Tilney and Van Wyk, 2001 ). The high level of incongruence between cpDNA and nuclear rDNA suggests that hybridization and/or introgression may have been events in the early history of these plants, resulting in the similarities observed today among the species. While the extent of hybridization in the southern Africa flora is poorly known, numerous examples of naturally occurring hybrids have been reported (Goldblatt, 1978 ; Spies et al., 1987 ; Takatsu et al., 2001 ; Roodt and Spies, 2003 ). Given the diverse environments and recurring climatic changes in southern Africa, coupled with the predominant woody and perennial plants that in general can form interfertile hybrids, hybrid speciation was likely important in the flora of southern Africa.

ITS loci are generally assumed to be homogenized by concerted evolution, but factors such as hybridization, polyploidization, pseudogene formation, and incomplete intra- or interarray homogenization may result in different ITS sequences persisting in a genome (Álvarez and Wendel, 2003 ), such as those detected here for Chamarea longipedicellata and, possibly, C. gracillima. Divergent sequence types within an individual could interfere with sequencing and may explain why several species of Annesorhiza and Chamarea (not included in this study) consistently yielded poor data from direct sequencing. The existence of divergent paralogous ITS sequences has also been reported in other Apiaceae. In Oreomyrrhis Endl. (tribe Scandiceae), intraindividual paralogous ITS sequences within each of 10 accessions representing nine species coalesced with the sequence obtained via direct sequencing and did not interfere with the phylogeny reconstruction (Chung et al., 2005 ). These ITS clones differed from direct sequenced ITS by one to four substitutions over the entire ITS region, with these polymorphisms imperceptible from the electropherogram of direct sequencing. Similarly, ITS sequence heterogeneity was detected in multiple accessions of Sium medium Fisch. & C. A. Mey. and Berula erecta (Huds.) Coville (tribe Oenantheae), but polymorphisms were restricted to very few sites, and, again, the paralogy did not impede phylogenetic inference (Spalik and Downie, 2006 ). In Chamarea longipedicellata, however, each of the three positive transformants sequenced yielded a different sequence type, with up to 18 nucleotide differences detected in ITS-1. Such highly divergent paralogous sequences complicate phylogenetic reconstruction. While two ITS clones formed a clade with Chamarea snijmaniae, a relationship supported in part by the plastid data, the third clone allied unexpectedly with Annesorhiza altiscapa, differing by only four substitutions. We expect that further molecular cloning of C. longipedicellata will reveal additional ITS polymorphisms. We also suppose that intraindividual ITS polymorphism within accessions of Annesorhiza and Chamarea may be widespread, given the difficulties we had in generating data from direct sequencing. Future studies of these taxa must be undertaken with low-copy nuclear genes. These markers are with rare exception not subjected to concerted evolution and may elucidate the possible role of hybridization in the evolution of these taxa and parentage of polyploids (Álvarez and Wendel, 2003 ; Soltis et al., 2003 ).

Molopospermum, Astydamia, and Choritaenia
Molopospermum is a weakly supported sister group to the Annesorhiza clade in the rps16 intron trees and, on this basis, was considered with Annesorhiza and Chamarea in the ITS analysis. The taxonomic placement of the monotypic Molopospermum has long been controversial (reviewed in Downie et al., 2000a ). In a revised classification of subfamily Apioideae (Downie et al., 2001 ), Molopospermum was provisionally included in tribe Pleurospermeae based on the serological studies of Shneyer et al. (1992) who found that Molopospermum and the "Physospermum-Pleurospermum alliance" reported therein were serologically distinct and most distant from all other Apioideae investigated. An earlier ITS study supported the affinity between Molopospermum and Physospermum, but sampling of putatively allied taxa was minimal, with only Physospermum and Komarovia considered (Downie et al., 2000a ). The rps16 intron trees support a position for the European Molopospermum heretofore unconsidered in any previous study, as sister species to a clade comprising the southern African genera Annesorhiza, Chamarea, and Itasina. Fruit structural features, such as the presence of lateral wings on one of the two mericarps and an abundance of crystals in the mesocarp, also support this relationship (Liu, 2004 ). The results of the ITS analysis reveal another surprise, that is, the sister group relationship between Molopospermum and the Canary Islands endemic genus Astydamia. A comparison of the fruits of these two genera is currently underway. Choritaenia is a monotypic genus endemic to southern Africa. It has been treated previously in either subfamilies Hydrocotyloideae (Pimenov and Leonov, 1993 ) or Apioideae (Bentham, 1867 ; Van Wyk, 2000 ), and its inclusion in the same matrix as Annesorhiza and allies was based on the similarity of its ITS sequence with these taxa. However, the placement of Choritaenia as sister group to the Annesorhiza clade plus Molopospermum + Astydamia may be the result of the relatively small sampling of taxa in this matrix, and its phylogenetic position needs confirmation through analysis of cpDNA data. Unfortunately, the difficulty in obtaining quality sequences from the Choritaenia rps16 intron despite repeated efforts with direct sequencing of PCR products suggests that molecular cloning will be necessary to obtain these data.

Tribe Heteromorpheae
The previously delimited Heteromorpha clade (Downie et al., 1998 ) was recognized as a tribe by Downie et al. (2000b) to include the endemic African genera Anginon, Dracosciadium, Glia, Heteromorpha, and Polemannia. The tribe is of evolutionary interest because of its putative sister group relationship to all other examined Apioideae in earlier studies, the predominantly woody habit of its members, and its largely southern African distribution. Downie and Katz-Downie (1999) reported that the genus Heteromorpha was not monophyletic, a surprising find given its unusual heteromorphic winged mericarps derived from the expansion of all five sepaline ribs; this type of wing development was described previously as an apomorphy of the genus (Winter et al., 1993 ; Winter and Van Wyk, 1996 ). Furthermore, in the study by Downie and Katz-Downie (1999) , the relationships among Anginon, Glia, Polemannia, and Heteromorpha arborescens var. arborescens could not be resolved because of a lack of informative characters.

With a three-fold increase in sampling from previous studies and additional data from the ITS region, we revise the circumscription of tribe Heteromorpheae to comprise Anginon, Dracosciadium, Glia, Heteromorpha, "Oreofraga," Polemannia, and Pseudocarum. We also include the endemic Madagascan genera Andriana B-E. van Wyk, Anisopoda Baker, Cannaboides B-E. van Wyk, Pseudocannaboides B-E. van Wyk, and Tana B-E. van Wyk. Anginon, Heteromorpha, and Polemannia are each resolved as monophyletic based on analyses of ITS or combined ITS and cpDNA data. We recommend that the concept of Anginon be expanded to include Glia because G. prolifera is the type of the genus and is placed well within Anginon, but such a change must await a generic revision of Glia currently in preparation (B-E. van Wyk and P. Tilney, unpublished manuscript). Anginon and Glia share heavily thickened and cutinized outer walls of the fruit epidermal cells and have been previously considered monophyletic sister taxa (Van Wyk et al., 1997 ). Intrageneric relationships in Anginon and Heteromorpha are generally unresolved or poorly supported, and it is apparent that more rapidly evolving markers are necessary to resolve relationships within these presumably recently radiated lineages. The eastern African and Madagascan genus Pseudocarum is paraphyletic, thus future studies of this genus should include "Oreofraga" and other Socotran endemics. We also include in the tribe the genera Andriana, Cannaboides, Pseudocannaboides, and Tana that at one time were considered in Heteromorpha (Humbert, 1956 ) but are now each regarded as distinct and closely related to Pseudocarum (Winter and Van Wyk, 1996 ; Van Wyk et al., 1999 ). These genera share a similar fruit structure (Liu, 2004 ), and cladistic analysis of 15 morphological characters indicates a close relationship between them and Heteromorpha (Van Wyk, 2001 ). Furthermore, our ongoing molecular studies of African Apiaceae, while still preliminary, indicate that these Madagascan genera together with Pseudocarum, "Oreofraga," Dracosciadium, and Anisopoda bupleuroides Baker comprise a well-supported clade that is sister group to the clade of Heteromorpha, Anginon, Glia, and Polemannia.

Tribes Pleurospermeae and Erigenieae and clades Komarovia and Physospermopsis
Tribe Pleurospermeae (Aulacospermum, Eleutherospermum, Physospermum, and Pleurospermum) is maintained as a strongly supported and well-resolved monophyletic group in the ITS study (Fig. 4B). In the rps16 intron trees (Figs. 2 and 3), these genera comprise two lineages whose relationship is unresolved, a result attributable to too few supporting characters. The tribe is monophyletic, however, as revealed by phylogenetic analyses of a variety of data sets (Downie et al., 2000b , 2001 ). Valiejo-Roman et al. (2002a) also include Hymenidium foetens (Franchet) Pimenov & Kljuykov, a species usually treated in Pleurospermum (Pan and Watson, 2005 ), alongside members of tribe Pleurospermeae. The Komarovia clade (circumscribed previously to include Komarovia and Parasilaus and tentatively Hansenia and Physospermopsis; Katz-Downie et al., 1999 ; Downie et al., 2000b , c , 2001 ) is redefined in light of the current study to comprise only Komarovia, Parasilaus, and Cyclorhiza. This clade received strong bootstrap support. Sister group to the Komarovia clade is a moderately supported clade (66% bootstrap) comprising Physospermopsis, Trachydium, Tongoloa, Sinolimprichtia, Hansenia, Notopterygium, and Haplosphaera. This group encompasses many plants from the Sino-Himalayan region of southwestern China and includes some genera whose taxonomic limits are not at all clear, such as Physospermopsis, Trachydium, and Tongoloa (Valiejo-Roman et al., 2002a ; She et al., 2005 ). We refer to this group provisionally as the Physospermopsis clade.

The North American monotypic genus Erigenia is sister group to the Komarovia and Physospermopsis clades in the ITS trees, and in the rps16 intron trees, it is a sister group to the Heracleum through Oenanthe clade, adjacent to the Komarovia clade. In all molecular phylogenies to date where Erigenia is included (e.g., Downie and Katz-Downie, 1999 ; Katz-Downie et al., 1999 ; Downie et al., 2000b , 2002 ), the genus constitutes an isolated lineage. Such phylogenies include those resulting from analyses of all North American umbellifers (S. R. Downie, unpublished data). We recognize Erigenia bulbosa as constituting the monotypic tribe Erigenieae, as erected by Rydberg (1932) .

Stenosemis, Dasispermum, Deverra, and Peucedanum
The southern African endemic genus Stenosemis was recognized by Sonder (1862) and soon thereafter was reduced to Annesorhiza by Bentham (1867) . Although Drude (1868) commented that the generic characters of Stenosemis were suggestive of his Peucedaneae subtribe Angelicinae and not Annesorhiza, he maintained Stenosemis as a subgenus of the latter. Burtt (1979 , 1991 ) recognized Stenosemis and Annesorhiza as distinct genera, and their separation is corroborated in the rps16 intron trees (Figs. 2 and 3) where Stenosemis caffra is placed quite a distance away from the Annesorhiza clade. The two South African members of Deverra examined fell within the Apium clade. This placement is consistent with previous studies (Downie et al., 2000a , c ) that show Deverra triradiata, from Saudi Arabia, also in the same clade. The genus Peucedanum sensu lato, as commonly circumscribed, contains some 100–120 species of largely African and Eurasian distribution (Pimenov and Leonov, 1993 ); the close relationship between the African and Eurasian species, however, has been challenged (e.g., Ostroumova and Pimenov, 1997a , b ). In the Bayesian tree (Fig. 3), the five woody species of South African Peucedanum and Dasispermum suffruticosum constitute a well-supported monophyletic group. Preliminary molecular results support the idea that the woody southern African species of Peucedanum (together with several other African genera, such as Dasispermum, Sonderina, and Stenosemis) are monophyletic and that this clade is not directly related to the Eurasian Peucedanum species (P. Winter et al., University of Johannesburg and South African National Biodiversity Institute, unpublished manuscript). It is supposed that this group of woody southern African peucedanums may represent a new genus subendemic to the Cape Floristic Region.

Southern African origin of Apioideae
All biogeographic reconstructions support a southern African origin of subfamily Apioideae with subsequent migration northward into Eurasia. Whether the ancestors of Apioideae had a more widespread distribution in Africa, however, cannot be ruled out completely. Such a scenario was reconstructed as one of two alternatives (the other being strictly southern) when a sub-Saharan African distribution was assumed for the ancestors of tribe Heteromorpheae. We consider this reconstruction to be the least likely. Many members of tribe Heteromorpheae are distributed exclusively in southern Africa, with only very few species occurring in Ethiopia and Yemen (including Socotra). Moreover, a strictly southern African origin of the subfamily is also supported by a dispersal–vicariance analysis of the results of the Heteromorpheae ITS analysis (Fig. 4A), in which it was similarly revealed that the ancestors of the tribe were likely distributed in southern Africa (data not shown). We suggest the biogeographic hypothesis presented in Fig. 5A is the most likely reconstruction. In this scenario, two dispersal events from the same ancestor within Apioideae are implied, one taking place in the lineage of the Annesorhiza clade + Molopospermum (plus Astydamia in the ITS trees; Fig. 4C) and the other in its sister group (i.e., Heteromorpheae through the apioid superclade and its allies). This means that the subsequent diversification of these clades took place through two dispersal routes: (1) from southern Africa through northwestern Africa to the Canary Islands (where Astydamia is endemic) and from there to Europe (Molopospermum is endemic to the Pyrenees, Massif Central, and the southern Alps) and (2) from southern Africa through northeastern Africa to Eurasia, whereupon most of the successive lineages of Apioideae diversified. The northward migration of the subfamily from southern Africa to Eurasia via the Middle East and the Caucasus was hypothesized previously by Plunkett et al. (1996a) based on present-day patterns of distribution. The African taxa that occur within the most recently radiated clades (i.e., Dasispermum, Deverra, Peucedanum, and Stenosemis) likely represent later dispersal events to Africa. It appears that the African continent was the center of origin of the first ancestors of Apioideae that subsequently migrated northward to Eurasia (possibly via two different dispersal routes), but it also received successive lineages that dispersed from other continents back to Africa.

On the origin of the woody habit
Traditionally, the largely herbaceous family Apiaceae has been envisioned as a specialized group derived from the mostly woody family Araliaceae. As a consequence, many workers interpreted the features predominating in Araliaceae as ancestral and those in Apiaceae as derived. Therefore, umbellifers with a woody habit were postulated to be "primitive" within Apiaceae. On the basis of previous molecular systematic studies showing the woody members of subfamily Apioideae endemic to southern Africa as sister group to all other apioid taxa, researchers have suggested that this character-state was potentially plesiomorphic and that the subfamily probably had a woody ancestry (Downie and Katz-Downie, 1996 , 1999 ; Plunkett et al., 1996a ; Chandler and Plunkett, 2004 ). The placement of herbaceous Lichtensteinia and Annesorhiza among the earliest diverging lineages within Apioideae, however, presents a different hypothesis on the ancestral habit of the subfamily. Optimization of the character habit onto the plastid-derived trees rejects the prevailing hypothesis that the woody habit is plesiomorphic and instead supports an alternative hypothesis that the ancestors of subfamily Apioideae were herbaceous. The latter is supported even if the ancestors of subfamilies Azorelloideae and Mackinlayoideae, and even those of the Hermas clade, were coded as woody. The ancestors of the predominantly woody tribe Heteromorpheae are ambiguously reconstructed, further suggesting that woodiness might be a derived state within the tribe, contrary to what has been assumed generally.

Woodiness (shrubs or small trees) occurs in about 20 genera from all three traditionally recognized subfamilies of Apiaceae, and within Apioideae the woody habit has arisen multiple times from herbaceous ancestors in a diversity of lineages (Rodriguez, 1971 ; Oskolski, 2001 ). In our study, such woody taxa include Heteromorpha and its allies (Heteromorpheae), South African Peucedanum, Bupleurum fruticosum (Bupleureae), and Steganotaenia/Polemanniopsis (the last two genera form a clade that may be sister group to subfamily Saniculoideae). Other genera, such as Diplolophium, Deverra, and Stenosemis, have been described as either herbaceous or woody. The endemic plants of southern Africa are not a random assemblage with regard to growth form and other biological attributes (Cowling and Hilton-Taylor, 1997 ). Shrubs are dominant in the region; this dominance is largely explained by the nutrient-poor soils that favor shrub growth (Goldblatt and Manning, 2002 ). It is then not surprising that this habit has arisen independently, and multiple times in this environment, within Apiaceae. Investigations of other plants are providing greater insight into the evolution of the woody habit from herbaceous ancestors. Using genomic and molecular tools in Arabidopsis Heynh. and Populus L., Kirst et al. (2003) reported that secondary growth may appear as a result of modifying the expression of genes already present in herbaceous progenitors. Although this does not discard the possibility of woody growth arising de novo by convergent evolution, the former explanation is more likely in cases where the frequency and rapidity of such events is high, as might be the case within a single lineage.

FOOTNOTES

1 The authors thank D. Katz-Downie, F. Sun, C. Carr, B. Robertson, B. Patel, and J. Heilveil for assistance in the laboratory, the curators of herbaria cited in the text for access to specimens, K. Spalik for providing DNAs, and D. Katz-Downie, S. Martínez, F. Zuloaga, and two anonymous reviewers for helpful comments on the manuscript. This work was supported by grants to S. R. Downie from the National Science Foundation (DEB 0089452) and the National Center for Supercomputing Applications (DEB 030005N), utilizing the IBM pSeries 690 system at the University of Illinois at Urbana-Champaign (UIUC). Travel funds to C. I. Calviño were provided by UIUC's School of Integrative Biology Enhancement Fund and the Department of Plant Biology John R. Laughnan Award. This paper represents part of a Ph.D. dissertation (C.I.C.), for which funding from CONICET is gratefully acknowledged. Back

2 Author for correspondence (ccalvino{at}life.uiuc.edu ) Back

LITERATURE CITED

Allison I. van Wyk B-E.. 1997. A revision of the genus Anginon (Apiaceae). Nordic Journal of Botany 17: 561-577.[CrossRef][Web of Science]

Álvarez I. Wendel J. F.. 2003. Ribosomal ITS sequences and plant phylogenetic inference. Molecular Phylogenetics and Evolution 29: 417-434.[CrossRef][Web of Science][Medline]

Barker F. K. Lutzoni F. M.. 2002. The utility of the incongruence length difference test. Systematic Biology 51: 625-637.[CrossRef][Web of Science][Medline]

Bentham G.. 1867. Umbelliferae. In G. Bentham, J. D. Hooker [eds.], Genera plantarum, vol. 1 859-931 Lovell Reeve, London, UK.

Burtt B. L.. 1979. Umbelliferae. Notes on some plants of southern Africa chiefly from Natal: VIII. Notes from the Royal Botanic Garden Edinburgh 37: 319-325.

Burtt B. L.. 1991. Umbelliferae of southern Africa: an introduction and annotated checklist. Edinburgh Journal of Botany 48: 133-282.

Chandler G. T. Plunkett G. M.. 2004. Evolution in Apiales: nuclear and chloroplast markers together in (almost) perfect harmony. Botanical Journal of the Linnean Society 144: 123-147.[CrossRef]

Chung K.-F. Peng C.-I. Downie S. R. Spalik K. Schaal B. A.. 2005. Molecular systematics of the trans-Pacific alpine genus Oreomyrrhis (Apiaceae): phylogenetic affinities and biogeographic implications. American Journal of Botany 92: 2054-2071.[Abstract/Free Full Text]

Cowling R. M. Hilton-Taylor C.. 1997. Phytogeography, flora and endemism. In R. M. Cowling, D. M. Richardson, S. M. Pierce [eds.], Vegetation of southern Africa 43-61 Cambridge University Press, Cambridge, UK.

Downie S. R. Hartman R. L. Sun F.-J. Katz-Downie D. S.. 2002. Polyphyly of the spring-parsleys (Cymopterus): molecular and morphological evidence suggests complex relationships among the perennial endemic genera of western North American Apiaceae. Canadian Journal of Botany 80: 1295-1324.[CrossRef][Web of Science]

Downie S. R. Katz-Downie D. S.. 1996. A molecular phylogeny of Apiaceae subfamily Apioideae: evidence from nuclear ribosomal DNA internal transcribed spacer sequences. American Journal of Botany 83: 234-251.[CrossRef][Web of Science]

Downie S. R. Katz-Downie D. S.. 1999. Phylogenetic analysis of chloroplast rps16 intron sequences reveals relationships within the woody southern African Apiaceae subfamily Apioideae. Canadian Journal of Botany 77: 1120-1135.[CrossRef][Web of Science]

Downie S. R. Katz-Downie D. S. Cho K. J.. 1996. Phylogenetic analysis of Apiaceae subfamily Apioideae using nucleotide sequences from the chloroplast rpoC1 intron. Molecular Phylogenetics and Evolution 6: 1-18.[Medline]

Downie S. R. Katz-Downie D. S. Spalik K.. 2000a. A phylogeny of Apiaceae tribe Scandiceae: evidence from nuclear ribosomal DNA internal transcribed spacer sequences. American Journal of Botany 87: 76-95.[Abstract/Free Full Text]

Downie S. R. Katz-Downie D. S. Watson M. F.. 2000b. A phylogeny of the flowering plant family Apiaceae based on chloroplast DNA rpl16 and rpoC1 intron sequences: towards a suprageneric classification of subfamily Apioideae. American Journal of Botany 87: 273-292.[Abstract/Free Full Text]

Downie S. R. Plunkett G. M. Watson M. F. Spalik K. Katz-Downie D. S. Valiejo-Roman C. M. Terentieva E. I. Troitsky A. V. Lee B.-Y. Lahham J. El-Oqlah A.. 2001. Tribes and clades within Apiaceae subfamily Apioideae: the contribution of molecular data. Edinburgh Journal of Botany 58: 301-330.[CrossRef]

Downie S. R. Ramanath S. Katz-Downie D. S. Llanas E.. 1998. Molecular systematics of Apiaceae subfamily Apioideae: phylogenetic analyses of nuclear ribosomal DNA internal transcribed spacer and plastid rpoC1 intron sequences. American Journal of Botany 85: 563-591.[Abstract]

Downie S. R. Watson M. F. Spalik K. Katz-Downie D. S.. 2000c. Molecular systematics of Old World Apioideae (Apiaceae): relationships among some members of tribe Peucedaneae sensu lato, the placement of several island-endemic species, and resolution within the apioid superclade. Canadian Journal of Botany 78: 506-528.[CrossRef][Web of Science]

Doyle J. J. Doyle J. L.. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry Bulletin 19: 11-15.

Drude C. G. O.. 1898. Umbelliferae. In A. Engler, K. Prantl [eds.], Die natürlichen Pflanzenfamilien, vol. 3 63-250 Wilhelm Engelmann, Leipzig, Germany.

Farris J. S. Källersjö M. Kluge A. G. Bult C.. 1995. Constructing a significance test for incongruence. Systematic Biology 44: 570-572.[CrossRef]

Felsenstein J.. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791.[CrossRef][Web of Science]

Goldblatt P.. 1978. An analysis of the flora of southern Africa: its characteristics, relationships, and origins. Annals of the Missouri Botanical Garden 65: 369-436.[CrossRef][Web of Science]

Goldblatt P. Manning J. C.. 2002. Plant diversity of the Cape region of southern Africa. Annals of the Missouri Botanical Garden 89: 281-302.[CrossRef][Web of Science]

Hardway T. M. Spalik K. Watson M. F. Katz-Downie D. S. Downie S. R.. 2004. Circumscription of Apiaceae tribe Oenantheae. South African Journal of Botany 70: 393-406.[Web of Science]

Hillis D. M. Huelsenbeck J. P.. 1992. Signal, noise and reliability in molecular phylogenetic analyses. Journal of Heredity 83: 189-195.[Abstract/Free Full Text]

Holmgren P. K. Holmgren N. H. Barnett L. C.. 1990. Index herbariorum New York Botanical Garden, New York, New York, USA.

Huelsenbeck J. P. Ronquist F.. 2001. MrBayes. Bayesian inference of phylogenetic trees. Bioinformatics 17: 754-755.[Abstract/Free Full Text]

Humbert H.. 1956. Contributions à l'étude de la flore de Madagascar et des Comores. Fascicule 5. Notulae Systematicae (Paris) 15: 113-134.

Jeanmougin F. Thompson J. D. Gouy M. Higgins D. G. Gibson T. J.. 1998. Multiple sequence alignment with Clustal X. Trends in Biochemical Sciences 23: 403-405.[CrossRef][Web of Science][Medline]

Katz-Downie D. S. Valiejo-Roman C. M. Terentieva E. I. Troitsky A. V. Pimenov M. G. Lee B. Downie S. R.. 1999. Towards a molecular phylogeny of Apiaceae subfamily Apioideae: additional information from nuclear ribosomal DNA ITS sequences. Plant Systematics and Evolution 216: 167-195.

Kirst M. Johnson A. F. Baucom C. Ulrich E. Hubbard K. Staggs R. Paule C. Retzel E. Whetten R. Sederoff R.. 2003. Apparent homology of expressed genes from wood-forming tissues of loblolly pine (Pinus taeda L.) with Arabidopsis thaliana. Proceedings of the National Academy of Sciences, USA 100: 7383-7388.[Abstract/Free Full Text]

Koso-Poljansky B. M.. 1916. Sciadophytorum systematis lineamenta: mantissa prior. Bulletin de la Société Impériale des Naturalistes (Moscou) 30: 277-290.

Liu M. R.. 2004. A taxonomic evaluation of fruit structure in the family Apiaceae Ph.D. dissertation, Rand Africaans University, Auckland Park, South Africa.

Liu M. R. van Wyk B-E. Tilney P. M.. 2003. The taxonomic value of fruit structure in the subfamily Saniculoideae and related African genera (Apiaceae). Taxon 52: 261-270.[CrossRef][Web of Science]

Maddison D. R. Maddison W. P.. 2005. MacClade 4: analysis of phylogeny and character evolution, version 4.07 Sinauer, Sunderland, Massachusetts, USA.

Michel F. Umesono K. Ozeki H.. 1989. Comparative and functional anatomy of group II catalytic introns: a review. Gene 82: 5-30.[CrossRef][Web of Science][Medline]

Neuhaus H. Scholz A. Link G.. 1989. Structure and expression of a split chloroplast gene from mustard (Sinapsis alba): ribosomal protein gene rps16 reveals unusual transcriptional features and complex RNA maturation. Current Genetics 15: 63-70.[CrossRef][Web of Science][Medline]

Neves S. S. Watson M. F.. 2004. Phylogenetic relationships in Bupleurum (Apiaceae) based on nuclear ribosomal DNA ITS sequence data. Annals of Botany 93: 379-398.[Abstract/Free Full Text]

Olmstead R. G. Palmer J. D.. 1994. Chloroplast DNA systematics: a review of methods and data analysis. American Journal of Botany 81: 1205-1224.[CrossRef][Web of Science]

Oskolski A. A.. 2001. Phylogenetic relationships within Apiales: evidence from wood anatomy. Edinburgh Journal of Botany 58: 201-206.[CrossRef]

Ostroumova T. A. Pimenov M. G.. 1997a. Carpological diversity of African Peucedanum s.l. (Umbelliferae) I. The species of southern Africa. Feddes Repertorium 108: 299-318.

Ostroumova T. A. Pimenov M. G.. 1997b. Carpological diversity in African Peucedanum s.l. (Umbelliferae) II. The species of tropical Africa. Feddes Repertorium 108: 533-547.

Pan Z. Watson M. F.. 2005. Pleurospermum. In Flora of China Editorial Committee [ed.], Flora of China vol. 14: 40 Missouri Botanical Garden Press, St. Louis, Missouri, USA.

Petersen G. Seberg O. Larsen S.. 2002. The phylogenetic and taxonomic position of Lilaeopsis (Apiaceae), with notes on the applicability of ITS sequence data for phylogenetic reconstruction. Australian Systematic Botany 15: 181-191.[CrossRef][Web of Science]

Pimenov M. G. Leonov M. V.. 1993. The genera of the Umbelliferae: a nomenclator Royal Botanic Gardens, Kew, UK.

Plunkett G. M. Chandler G. T. Lowry P. P. II Pinney S. M. Sprenkle T. S.. 2004. Recent advances in understanding Apiales and a revised classification. South African Journal of Botany 70: 371-381.[Web of Science]

Plunkett G. M. Lowry P. P. II. 2001. Relationships among "ancient araliads" and their significance for systematics of Apiales. Molecular Phylogenetics and Evolution 19: 259-276.[CrossRef][Web of Science][Medline]

Plunkett G. M. Soltis D. E. Soltis P. S.. 1996a. Evolutionary patterns in Apiaceae: inferences based on matK sequence data. Systematic Botany 21: 477-495.[CrossRef][Web of Science]

Plunkett G. M. Soltis D. E. Soltis P. S.. 1996b. Higher level relationships of Apiales (Apiaceae and Araliaceae) based on phylogenetic analysis of rbcL sequences. American Journal of Botany 83: 499-515.[CrossRef][Web of Science]

Posada D. Buckley T. R.. 2004. Model selection and model averaging in phylogenetics: advantages of Akaike information criterion and Bayesian approaches over likelihood ratio tests. Systematic Biology 53: 793-808.[CrossRef][Web of Science][Medline]

Posada D. Crandall K. A.. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14: 817-818.[Abstract/Free Full Text]

Rodríguez R. L.. 1971. The relationships of the Umbellales. In V. H. Heywood [ed.], The biology and chemistry of the Umbelliferae 63-91 Academic Press, London, U.K.

Ronquist F.. 1996. DIVA, version 1.1 for MacOS and Win32 Computer program and documentation distributed by the author, website http://www.ebc.uu.se/systzoo/research/diva/diva.html [Accessed 21 June 2005].

Roodt R. Spies J. J.. 2003. Chromosome studies in the grass subfamily Chloridoideae II. An analysis of polyploidy. Taxon 52: 736-746.[CrossRef][Web of Science]

Rydberg P. A.. 1932. Ammiaceae. Flora of the prairies and plains of central North America, 586 New York Botanical Garden, New York, New York, USA.

She M. Pu F. Pan Z. Watson M. F. Cannon J. F. M. Holmes-Smith I. Kljuykov E. V. Phillippe L. R. Pimenov M. G.. 2005. Apiaceae. In Flora of China Editorial Committee [ed.], Flora of China, vol. 14 1-205 Missouri Botanical Garden Press, St. Louis, Missouri, USA.

Shneyer V. S. Borschtschenko G. P. Pimenov M. G. Leonov M. V.. 1992. The tribe Smyrnieae (Umbelliferae) in the light of serotaxonomical analysis. Plant Systematics and Evolution 182: 135-148.[CrossRef][Web of Science]

Soltis D. E. Soltis P. S. Tate J. A.. 2003. Advances in the study of polyploidy since Plant Speciation. New Phytologist 161: 173-191.[CrossRef][Web of Science]

Soltis P. S. Doyle J. J. Soltis D. E.. 1992. Molecular data and polyploid evolution in plants. In P. S. Soltis, D. E. Soltis, J. J. Doyle [eds.], Molecular systematics of plants 177-201 Chapman and Hall, New York, New York, USA.

Sonder W.. 1862. Umbelliferae. In W. H. Harvey, W. Sonder [eds.], Flora capensis vol. 2: 524-567 Hodges, Smith and Co., Dublin, Ireland.

Spalik K. Downie S. R.. 2006. The evolutionary history of Sium sensu lato (Apiaceae): dispersal, vicariance, and domestication as inferred from ITS rDNA phylogeny. American Journal of Botany 93: 747-761.[Abstract/Free Full Text]

Spies J. J. Stirton C. H. Du Plessis H.. 1987. The genus Rubus (Rosaceae) in southern Africa. IV. Natural hybridization. Bothalia 17: 105-120.[Web of Science]

Swofford D. L.. 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4.0 b10 Sinauer, Sunderland, Massachusetts, USA.

Swofford D. L. Olsen G. J.. 1990. Phylogeny reconstruction. In D. M. Hillis, C. Moritz [eds.], Molecular systematics 411-501 Sinauer Associates, Sunderland, Massachusetts, USA.

Takatsu Y. Miyamoto M. Inoue E. Yamada T. Manabe T. Kasumi M. Hayashi M. Sakuma F. Marubashi W. Niwa M.. 2001. Interspecific hybridization among wild Gladiolus species of southern Africa based on randomly amplified polymorphic DNA markers. Scientia Horticulturae 91: 339-348.[CrossRef]

Tilney P. M. van Wyk B-E.. 2001. A revision of the genus Annesorhiza (Apiaceae). Nordic Journal of Botany 21: 615-649.[CrossRef][Web of Science]

Tseng C. C.. 1967. Anatomical studies of flower and fruit in the Hydrocotyloideae (Umbelliferae). University of California Publications in Botany 42: 1-58.[Medline]

Valiejo-Roman C. M. Shneyer V. S. Samigullin T. H. Terentieva E. I. Pimenov M. G.. 2006. An attempt to clarify taxonomic relationships in "Verwandtschaftskreis der Gattung Ligusticum" (Umbelliferae-Apioideae) by molecular analysis. Plant Systematics and Evolution 257: 25-43.[CrossRef][Web of Science]

Valiejo-Roman C. M. Terentieva E. I. Samigullin T. H. Pimenov M. G.. 2002a. nrDNA ITS sequences and affinities (Umbelliferae) of Sino-Himalayan Apioideae. Taxon 51: 685-701.[CrossRef][Web of Science]

Valiejo-Roman C. M. Terentieva E. I. Samigullin T. H. Pimenov M. G.. 2002b. Relationships among genera in Saniculoideae and selected Apioideae (Umbelliferae) inferred from nrITS sequences. Taxon 51: 91-101.[CrossRef][Web of Science]

van Wyk B-E.. 2000. Apiaceae (Umbelliferae). In O. A. Leistner [ed.], Seed plants of southern Africa 62-71 National Botanical Institute, Pretoria, South Africa.

van Wyk B-E.. 2001. A preliminary analysis of evolution of African and Madagascan Apiaceae. Edinburgh Journal of Botany 58: 291-299.

van Wyk B-E. Allison I. Tilney P. M.. 1997. Morphological variation and phylogenetic relationships in the genus Anginon. Nordic Journal of Botany 17: 511-526.[CrossRef][Web of Science]

van Wyk B-E. Tilney P. M.. 1994. The taxonomic value of fruit wall structure in the genus Annesorhiza. South African Journal of Botany 60: 240-244.

van Wyk B-E. Tilney P. M.. 2001. The generic position of Annesorhiza filicaulis Eckl. & Zeyh. (Apiaceae). Edinburgh Journal of Botany 58: 383-387.

van Wyk B-E. Tilney P. M.. 2004. Diversity of Apiaceae in Africa. South African Journal of Botany 70: 433-445.[Web of Science]

van Wyk B-E. Tilney P. M. Winter P. J. D.. 1999. Four new genera of woody Apiaceae of Madagascar. Taxon 48: 737-745.[CrossRef][Web of Science]

Vessio N.. 2001. The generic affinities of deciduous species of the genera Annesorhiza Cham. & Schlechtd., Chamarea Eckl. & Zeyh. and Peucedanum L. (Apiaceae) M.S. thesis, Rand Africaans University, Auckland Park, South Africa.

Wilgenbusch J. C. Warren D. L. Swofford D. L.. 2004. AWTY: A system for graphical exploration of MCMC convergence in Bayesian phylogenetic inference Website http://ceb.csit.fsu.edu/awty [Accessed 17 June 2005].

Winter P. J. D. van Wyk B-E.. 1996. A revision of the genus Heteromorpha (Apiaceae). Kew Bulletin 51: 225-265.

Winter P. J. D. van Wyk B-E. Tilney P. M.. 1993. The morphology and development of the fruit of Heteromorpha (Apiaceae). South African Journal of Africa 59: 336-341.

Wolff H.. 1910. Umbelliferae-Apioideae-Bupleurum, Trinia et reliquae Ammineae heteroclitae. In A. Engler [ed.], Das Pflanzenreich, vol. IV 228 1-214 Wilhelm Engelmann, Leipzig, Germany.

Wolff H.. 1913. Umbelliferae-Saniculoideae. In A. Engler [ed.], Das Pflanzenreich, vol. IV 228 1-305 Wilhelm Engelmann, Leipzig, Germany.

Yoder A. D. Irwin J. A. Payseur B. A.. 2001. Failure of the ILD to determine data combinability for slow loris phylogeny. Systematic Biology 50: 408-424.[Web of Science][Medline]




This article has been cited by other articles:


Home page
Am. J. Bot.Home page
C. I. Calvino, S. G. Martinez, and S. R. Downie
Morphology and biogeography of Apiaceae subfamily Saniculoideae as inferred by phylogenetic analysis of molecular data
Am. J. Botany, February 1, 2008; 95(2): 196 - 214.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Calviño, C. I.
Right arrow Articles by Downie, S. R.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Calviño, C. I.
Right arrow Articles by Downie, S. R.
Agricola
Right arrow Articles by Calviño, C. I.
Right arrow Articles by Downie, S. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS