Am. J. Bot. Li-Cor Advertisement
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


  Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter
What's this?
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (25)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Busch, J. W.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Busch, J. W.
Agricola
Right arrow Articles by Busch, J. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
(American Journal of Botany. 2005;92:1503-1512.)
© 2005 Botanical Society of America, Inc.


Reproductive Biology

The evolution of self-compatibility in geographically peripheral populations of Leavenworthia alabamica (Brassicaceae)1

Jeremiah W. Busch2

Department of Biology, Indiana University, 1001 E. 3rd St., Bloomington, Indiana 47405 USA

Received for publication December 17, 2004. Accepted for publication June 15, 2005.

ABSTRACT

Self-compatibility and adaptations to self-fertilization are often found in plant populations at the periphery of species' ranges or on islands. Self-compatibility may predominate in these environments because it provides reproductive assurance when pollinators or availability of mates limits seed production. This possibility was studied in Leavenworthia alabamica, a flowering plant endemic to the southeastern United States. Populations at the center of the species' range retain sporophytic self-incompatibility, but peripheral populations are smaller, self-compatible, and have adaptations for self-fertilization. A reciprocal-transplant experiment was designed to test whether there is pollen limitation of seed set and to examine its strength in central and peripheral populations. Self-compatible genotypes produced more fruit and 17–22% more seed than self-incompatible genotypes in all environments, suggesting that the transition to self-compatibility may be favored by natural selection in all populations inhabited by L. alabamica. Sequence analyses demonstrated that two peripheral populations have 90–100% reductions in genetic variation, consistent with the effects of small population size or historical bottlenecks. Although pollen limitation of seed set occurs in all environments, self-compatibility may evolve at the periphery in L. alabamica because the benefits of reproductive assurance are influenced by population size or bottlenecks following extinction and colonization.

Key Words: Baker's law • Brassicaceae • cedar glades • inbreeding • mating system • pollen limitation • reproductive assurance • self-incompatibility

The evolution of self-fertilization from outcrossing is one of the most common evolutionary transitions in plants and has occurred in many taxonomic groups (Stebbins, 1974 ; Barrett and Shore, 1987 ; Barrett et al., 1989 ; Barrett et al., 1996 ; Kohn et al., 1996 ; Schoen et al., 1997 ; Takebayashi and Morrell, 2001 ; Barrett, 2002 ). One recurring theme is the association of peripheral, isolated, and island environments with self-compatible mating systems (Baker, 1955 , 1967 ; Stebbins, 1957 ; Lloyd, 1980 ; Barrett and Shore, 1987 ; Inoue et al., 1996 ; Schueller, 2004 ; Herlihy and Eckert, 2005 ). Self-compatibility may be restricted to these portions of species' ranges because of lower environmental quality (Brown, 1984 ; Sagarin and Gaines, 2002 ), such that pollinators or conspecific plants become scarce. If reduced pollinator activity or plant density causes pollen limitation of seed set in these peripheral environments, alleles conferring self-compatibility will spread within populations because the capacity to self-fertilize provides reproductive assurance (Moore and Lewis, 1965 ; Jain, 1976 ; Lloyd, 1979 , 1992 ).

Darwin (1876) was the first to suggest that inadequate pollinator service would favor the evolution of autonomous seed production by natural selection. This hypothesis for the evolution of self-fertilization has recently been tested in a variety of empirical systems (Barrett et al., 1998; Eckert and Schaefer, 1998 ; Fausto et al., 2001 ; Herrera et al., 2001 ; Herlihy and Eckert, 2002 ; Elle and Carney, 2003 ; Kalisz et al., 2004 ; Schueller, 2004 ). Investigators have either examined the effects of natural variation in pollinator availability on pollen limitation of seed set (Fausto et al., 2001 ; Herrera et al., 2001 ; Kalisz et al., 2004 ; Schueller, 2004 ; Moeller and Geber, 2005 ) or have experimentally manipulated the ability of plants to autonomously self-fertilize (Leclerc-Potvin and Ritland, 1994 ; Klips and Snow, 1997 ; Eckert and Schaefer, 1998 ; Herlihy and Eckert, 2002 ; Davis and Delph, 2005 ). Empirical attempts to test pollinator limitation must demonstrate either that (1) patterns of reduced pollinator visitation correlate with selection for self-fertilization in nature (Inoue et al., 1996 ; Fausto et al., 2001 ; Elle and Carney, 2003 ; Kalisz et al., 2004 ); or (2) individuals lacking the ability to autonomously self-fertilize produce fewer seeds (Leclerc-Potvin and Ritland, 1994 ; Klips and Snow, 1997 ; Eckert and Schaefer, 1998 ; Herrera et al., 2001 ; Herlihy and Eckert, 2002 ; Elle and Carney, 2003 ; Schueller, 2004 ; Davis and Delph, 2005 ).

Reproductive assurance and the benefits of self-compatibility may also be strongly influenced by plant density or population size (Baker, 1955 , 1967 ). Bottlenecks during the founding of new populations could strongly favor self-compatibility and explain the preponderance of self-compatible species on islands or in isolated regions of the species' range (Stebbins, 1957 ; Lloyd, 1980 ; Barrett et al., 1989 ; Inoue et al., 1996 ; Schueller, 2004 ). In species with genetically controlled self-incompatibility systems, reductions in plant density may dramatically limit the reproductive success of individuals, since low S-allele diversity can obviate the production of offspring through outcrossing (Wright, 1964 ; Byers and Meagher, 1992 ; Reinartz and Les, 1994 ; Pannell and Barrett, 1998 ; Fischer et al., 2003 ). In support of this idea, numerous researchers have shown that historical colonization and low plant density may favor the evolution of self-compatibility, although pollinator limitation likely also plays a role (Lloyd, 1980 ; Barrett et al., 1989 ; Eckert and Barrett, 1992 ; Schueller, 2004 ; Moeller and Geber, 2005 ).

Species of Leavenworthia are excellent candidates for the study of the ecological factors favoring the evolution of self-compatibility. A history of work in Leavenworthia suggests that selection for reproductive assurance has likely led to the independent evolution of self-compatibility four times among the eight extant species (Rollins, 1963 ; Lloyd, 1965 ; Solbrig and Rollins, 1977 ; Lyons and Antonovics, 1991 ). Single-locus, sporophytic self-incompatibility is found throughout the Brassicaceae (Bateman, 1955), is the ancestral mating system in the genus Leavenworthia (Lloyd, 1967 ; J. Beck, I. Al-Shehbaz, and B. Schaal, Washington University, unpublished data) and is absent in some populations of L. alabamica (Lloyd, 1965 ; Busch, 2005 ). This species is endemic to the Moulton Valley, a region in northern Alabama that is approximately 96 km long in an east–west direction and 5–16 km wide (Johnston, 1930 ). Differentiation among L. alabamica populations in self-compatibility, floral adaptations for self-fertilization, and vegetative morphology has led to their recognition as distinct land races (Lloyd, 1965 ). Previous work in this system has shown that populations at the center of the species' range are primarily composed of self-incompatible plants, whereas peripheral sites harbor many self-compatible plants (Map 1 in Lloyd, 1965 ). Self-compatible populations are thought to be highly self-fertilizing because flowers readily produce seed autonomously, lack spatial separation of the anthers and stigma, and possess many adaptations for self-pollination such as introrse anthers, short petals, short styles, and low pollen to ovule ratios (Rollins, 1963 ; Lloyd, 1965 ).

The narrow Moulton Valley of northern Alabama is composed of a rocky bed of limestone that is covered with an extremely thin layer of moist soil (Baskin et al., 1995 ). In such cedar glades, L. alabamica grows and is visited by several species of solitary bees (Andrena spp. and Halictus ligatus), which vigorously climb over the central comb containing the stigma and anthers (Lloyd, 1965 ). At the periphery of the Moulton Valley, the elevation rises 75 m on the Cumberland Plateau to the south and the Highland Rim to the north (Johnston, 1930 ). These changes in elevation are also associated with reductions in soil moisture and the availability of exposed rock. At the periphery of the species' range, cedar glades are smaller and more disturbed, populations are less dense, and from historical observations, native pollinators appear less common (Lloyd, 1965 ). All these factors may act in concert to selectively favor self-compatibility at the border of the Moulton Valley.

If the availability or activity of pollinators declines in peripheral populations of L. alabamica, then pollen limitation of seed set should be greater in these environments (Herrera et al., 2001 ; Schueller, 2004 ). If this hypothesis is true, self-compatible genotypes should produce more seed than self-incompatible genotypes, and this difference should be greatest in peripheral environments. If this hypothesis is not supported, then the evolution of self-compatibility in peripheral environments may be attributed to other ecological forces limiting pollen availability, such as small population size, low plant density, or reduced S-allele diversity (Byers and Meagher, 1992 ; Reinartz and Les, 1994 ; Pannell and Barrett, 1998 ; Fischer et al., 2003 ). In a reciprocal-transplant experiment, I tested the idea that pollen limitation of seed set is higher at the periphery of the species' range. Sequence diversity was analyzed in one self-incompatible and two peripheral self-compatible populations to determine if patterns of genetic variation were consistent with the role of small population size or historical bottlenecks in peripheral environments.

MATERIALS AND METHODS

Variation in self-compatibility
Leavenworthia alabamica Rollins (Alabama glade cress; Brassicaceae) is a winter annual, endemic to the limestone cedar glades of the Moulton Valley in northern Alabama, though a few populations are found in the Tennessee River Valley near Tuscumbia, AL (Rollins, 1963 ). Individuals of L. alabamica germinate in the late fall and grow very slowly during the winter months. Vegetative growth accelerates when temperatures warm in the late winter and plants begin to flower in early March. Seeds mature on maternal plants and are passively dispersed throughout late April and early May (Solbrig and Rollins, 1977 ). Pollen dispersal between populations is rare because of the small home-range of native bees (Lloyd, 1965 ). Gene flow between populations is thought to primarily occur following the dispersal of seeds by intermittent periods of flooding during the spring.

Floral morphology was studied in five self-incompatible populations (Hatton, Isbell, Newburg, Tharptown, and Waco) and five self-compatible populations (Landersville, Lebanon, Morgan/Huckaby Bridge, Russellville, and Tuscumbia; see Busch, 2005 for population locations). Plant density and population size were estimated in March 2003 by counting plants within 30 separate 0.093 m2 quadrats along two linear transects (Krebs, 1999 ; Table 1). Seeds were collected from these populations in late April and early May of 2003 and germinated in petri plates during October 2003. Seeds and seedlings were grown according to established protocols (Busch, 2005 ) to flowering in an Indiana University greenhouse.


View this table:
[in this window]
[in a new window]
 
Table 1. Populations of Leavenworthia alabamica used to study divergence in mating system. Mating system describes whether individual plants within the population are self-incompatible (SI) or self-compatible (SC). Races denote groups with varying levels of floral adaptations to self-fertilization (Lloyd, 1965). Underlined populations are sites used in the reciprocal-transplant experiment. Density and population size were estimated by quadrat sampling methods

 
Variation in self-compatibility and floral morphology was quantified in the greenhouse because previous work suggested that the self-incompatibility reaction of L. alabamica may be influenced by environmental variation (Levin, 1996 ). Petal length, pistil height, and the height of the paired stamens on the first or second flower produced by plants were measured to the nearest 0.01 mm. The rotation of the anther sacs on the paired stamens was also scored because this trait likely influences the ability of plants to autonomously self-fertilize (Lloyd, 1965 ). The convention of Rollins (1963) was used to quantify the rotation of the anther sacs away from the pistil according to discrete angles (45°, 90°, 135° or 180°; Lyons and Antonovics, 1991 ). All six stamens were carefully removed with forceps, and pollen grains were immersed in 5 mL of a 3 : 1 solution of lactic acid and glycerol and vortexed for 30 s, then 1/1,000th of this solution (5 µL) was placed onto a slide and mixed with 10 µL of Alexander's stain (Kearns and Inouye, 1993 ). The total number of pollen grains per flower was then estimated from counts of four replicate samples. Ovule number was counted using a dissecting microscope.

Self-compatibility and the rate of autonomous self-fertilization were measured on each plant. To determine the degree of self-compatibility, 10 newly opened flowers were forcibly self-pollinated on each individual. Each individual's degree of self-compatibility was scored as the fraction of hand-self-pollinated flowers that produced fruit (Charlesworth and Yang, 1998 ). The rate of autonomous self-fertilization was scored as the fraction of undisturbed flowers that produced fruit in a pollinator-free greenhouse. Autonomous self-fertilization in this experiment does not exclude the possibility of agamospermy, or the production of seed through asexual reproduction.

Differences between races in floral traits were evaluated with univariate analyses of variance and Tukey's post-hoc comparisons (Sokal and Rohlf, 1995 ). To minimize the effect of multiple comparisons, I ran significance tests with an alpha-corrected Bonferroni level of {alpha} = 0.01. The differences among populations within races were limited, so populations were grouped according to their race as originally designated by Lloyd (1965) .

Reciprocal-transplant experiment
A reciprocal-transplant experiment was conducted using two central and two peripheral sites that support self-incompatible (Isbell, Waco; Table 1) and self-compatible plants (Morgan, Tuscumbia; Table 1), respectively. In December 2003, 250 seedlings from each of four populations were removed from their native sites and placed in flats of soil. Efforts were made to minimize variation among individuals in their number of leaves at the start of the experiment. Approximately 50 individuals from each population were then transplanted into linear transects at each experimental site on 13–15 December and marked with rust-resistant nails. In the early part of March, utility crews planned to destroy the Morgan experimental site. Plants at this site were transplanted 500 meters downstream of the natural drainage, into a site supporting L. alabamica. Plants were watered at this site for 1 week to ensure that they survived transplantation.

During March and April, floral traits associated with autonomous self-fertilization were measured on all experimental plants. The date of flowering was recorded as the first day an individual produced an open flower. Petal length was recorded to the nearest 0.01 mm with digital calipers. The degree of anther rotation was also scored. Differences between self-incompatible and self-compatible genotypes in the afore-mentioned floral traits and time to flowering were evaluated within each site with t tests using a Bonferroni-corrected alpha level of {alpha} = 0.01. The total number of flowers and fruits produced during the lifetime of plants was measured at the end of the flowering season. The proportion of flowers that produced fruit on each individual plant was then counted at each experimental site. At the end of the flowering season, the aboveground biomass of plants was harvested, placed in bags, and dried in an oven at 50°C for 1 week. The number of matured seeds and aborted seeds per fruit were counted for all fruits and averaged for each individual plant.

Fruit and seed set were measured only on transplanted plants in each population. Separate univariate analyses of variance (ANOVAs) were conducted on these measures of seed production: (1) arcsine square-root transformed fruit set and (2) number of matured seeds per fruit. In both ANOVAs, experimental site and self-incompatibility type (i.e., genotype) were fixed effects, and "days to flowering" was used as a continuously distributed covariate. Populations were pooled according to their self-incompatibility type because these populations were randomly sampled to reflect variation caused by the transition from self-incompatibility to self-compatibility, and the differences between populations were limited. A significant interaction between site and genotype would suggest that the benefits of self-compatibility are environment dependent. Significance tests of the difference between self-incompatible and self-compatible genotypes were conducted using a Tukey's post-hoc test (Sokal and Rohlf, 1995 ). In analyses with a significant site by genotype interaction, the differences between self-incompatible and self-compatible genotypes were evaluated separately within each site. A univariate ANOVA was also conducted on the number of aborted seeds per fruit to determine if genotypes differed in their propensity to selectively abort developing offspring.

Sequencing neutral genetic diversity
Species of Leavenworthia possess only a single copy of the cytosolic phosphoglucose isomerase gene (Liu et al., 1999 ). Approximately 25 to 30 individuals from one self-incompatible and two self-compatible populations were sampled. Leaves from individual plants were flash frozen with liquid nitrogen, and genomic DNA was extracted using Qiagen DNeasy plant mini kits. An approximately 250-bp region corresponding to intron 12 was amplified using the plus primer AGTATGGCTTCTCCATGGTT (PGIC.P1) and a minus primer ATGTGGACTTGAAATGCTG (PGIC.2PR). Another pair of conserved primers was used to amplify an approximately 650-bp region containing several exons and introns 13, 14, and 15 of PgiC (PGI+14: AGGGAGCTTCAAGCATTGAT; PGI-4: TCGAACGGGAGAGGTAGACCA).

DNA was amplified using the PCR reaction conditions reported for intron 12 and introns 13–15 (Filatov and Charlesworth, 1999 ; Liu et al., 1999 ). Organic residues were removed from PCR products by using QIAquick PCR purification kits (Qiagen). DNA templates were cycle-sequenced in 10 µL reactions with 0.0002 µg of the forward primer (PGI.P1 or PGI+14), 1 µL v. 3.1 BigDye terminator ready reaction mix (Applied BioSystems, Foster City, California, USA) and 1.5 mM MgCl2. The procedure consisted of 25 cycles each of 30 s at 96°C, 15 s at 50°C, and 4 min at 60°C. The samples were sequenced with an ABI 3730 automated sequencer (Applied Biosystems). Sequences were aligned in Sequencher v. 4.1 (Gene Codes Corp., Ann Arbor, Michigan, USA). Individuals heterozygous at sites of insertion–deletion polymorphisms were excluded from analyses because of the inability to score nucleotides.

Haplotype structure was analyzed using Haplotyper software (Niu et al., 2002 ). Ambiguous base calls were corrected manually. The exons found in the region containing introns 13–15 were identified by alignment with an L. crassa mRNA (GenBank accession AF054455) and were removed before further analyses. In some cases, sequencing efforts in intron 12 and introns 13– 15 utilized different individuals, so these regions were analyzed separately. The haplotypes sequenced in intron 12 and introns 13–15 are GenBank accessions AY745782–AY745805. Measures of sequence diversity were estimated using DNAsp v. 4.0.0.4 (Rozas et al., 2003 ). The number of segregating sites per site (ps) and the populational heterozygosity, or nucleotide diversity per site ({pi}) were calculated. Insertion-deletion polymorphisms were coded as single nucleotide polymorphisms. The variance in nucleotide diversity was directly estimated by sampling with replacement from the original dataset of sequences 500 times. Nucleotide diversity within populations was statistically compared, assuming that the divergence between populations is recent (Innan and Tajima, 2002 ). Tajima's tests were conducted to test the hypothesis that populations are not at equilibrium between mutation and genetic drift (Tajima, 1989a ).

RESULTS

Variation in self-compatibility
Self-incompatible populations of L. alabamica are an order of magnitude larger than self-compatible populations (t = 13.83, df = 8, P = 0.001; Table 1). Although not statistically significant, self-incompatible populations also tend to have higher plant density in comparison to self-compatible populations (t = 1.586, df = 8, P = 0.151; Table 1). Self-incompatible plants produce very few fruits autonomously in the greenhouse (<2% of all flowers) and have large flowers with extrorse anthers and high pollen to ovule to ratios (Table 2). Although the self-incompatibility reaction of the Brassicaceae is leaky, there are discrete differences in its prevalence between the races. Of the 86 plants from the self-incompatible race (a1) measured in the greenhouse, two individuals produced seed more than 80% of the time following self-pollination, whereas the majority of plants accepted self pollen less than 10% of the time. Therefore, the majority of plants sampled from the a1 race are self-incompatible, although there may be a low frequency of alleles conferring self-compatibility in these populations (2/86 = 0.023).


View this table:
[in this window]
[in a new window]
 
Table 2. Floral trait divergence among the races of Leavenworthia alabamica. N denotes the numbers of individuals measured in the greenhouse experiment. Races are based upon a historical investigation of the differences among populations in the degree of self-compatibility, associated floral traits, and vegetative morphology (Lloyd, 1965). Self-compatibility is the fraction of hand self-pollinated flowers producing fruit, and autonomy rate equals the fraction of flowers producing fruit in a pollinator-free greenhouse. Pollen to ovule ratio equals the average number of pollen grains per flower divided by the average number of ovules per flower within a race. Standard errors of estimates are reported and superscripts denote significant differences between races at alpha = 0.01 level

 
Populations at the periphery of the Moulton Valley are often found in glades that have experienced disturbance and are less suitable for the growth of L. alabamica (Table 1). In these peripheral environments, all plants are self-compatible, have smaller flowers with introrse anthers, lower pollen to ovule ratios, and produce many fruits autonomously (>31% of all flowers; Table 2). The a2 race is an exception to these general trends because plants of this race are capable of autonomous self-fertilization, yet retain large flowers and extrorse anthers. The Russellville and Tuscumbia races of L. alabamica are the most self-compatible, have the highest rates of autonomous self-fertilization, and the lowest pollen to ovule ratios (Table 2). The results of the greenhouse experiment strongly support previous work on this species that suggested that the evolution of self-compatibility is associated with a large number of floral adaptations to autonomous self-fertilization in geographically peripheral populations (Lloyd, 1965 ).

Reciprocal-transplant experiment
In all field sites, plants transplanted from self-compatible populations produced smaller flowers with more introrse anthers compared to plants transplanted from self-incompatible populations (Fig. 1a, b). In the peripheral site which had to be re-transplanted (Morgan), self-incompatible plants flowered earlier and had higher lifetime flower production in comparison to self-compatible genotypes. There were no significant differences between the genotypes at the remaining sites, which were not watered during the spring (Fig. 1c, d). There was a significant interaction between site and genotype on patterns of fruit set (Table 3). This interaction resulted from self-compatible genotypes having a significantly higher fruit set than self-incompatible genotypes in all sites except the peripheral Tuscumbia site (Fig. 2). There was not a significant interaction between site and genotype on patterns of seed production per fruit (Table 4), with self-compatible plants producing a greater number of seeds per fruit in all environments (Fig. 3). Overall, self-compatible genotypes produced 17–22% more seeds per fruit compared to self-incompatible plants in all environments. Although not statistically significant, there was also a trend for self-compatible plants to abort more seeds per fruit in all sites (F1,479 = 3.422, P = 0.072; Fig. 3).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1. Floral traits of self-incompatible (SI) and self-compatible (SC) genotypes in the reciprocal-transplant experiment. (a) Petal length of the first flower (mm). (b) Degree of anther rotation away from the pistil. (c) Number of days from transplantation to the opening of the first flower. (d) Number of flowers produced over the lifetime of a plant. * denotes a significant difference between genotypes at the {alpha} = 0.01 level

 

View this table:
[in this window]
[in a new window]
 
Table 3. Univariate ANOVA describing variation in fruit set (R2 = 0.156) in Leavenworthia alabamica. Fruit set equals the proportion of flowers that produced fruit in natural populations. Fruit set val ues were arcsine square-root transformed for analyses. Genotype refers to whether plants were self-incompatible or self-compatible

 


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Fruit set of self-incompatible (SI) and self-compatible (SC) genotypes in the reciprocal-transplant experiment. Fruit set values equal the percentage of flowers that matured into fruit. Error bars denote 1 standard error, and * denotes a significant difference between genotypes at the {alpha} = 0.01 level

 

View this table:
[in this window]
[in a new window]
 
Table 4. Univariate ANOVA describing variation in the number of matured seeds per fruit in Leavenworthia alabamica (R2 = 0.365). Genotype refers to whether plants were self-incompatible or self-compatible

 


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3. Seed set of self-incompatible (SI) and self-compatible (SC) genotypes in the field experiment. Bars represent estimated marginal means. Dark portions of the stacked bars represent the average number of matured seeds per fruit, whereas light bars represent the number of aborted seeds per fruit. Self-compatible genotypes matured more seeds (P < 0.001; N = 487) and showed a trend for greater seed abortion (P = 0.072; N = 489)

 
Self-compatibility and sequence diversity
The self-incompatible Waco population had a nucleotide diversity of 1.1% within intron 12 and a nucleotide diversity of 1.8% within introns 13–15 (Table 5). In contrast, the self-compatible Morgan population was monomorphic over all intron sites and the self-compatible Tuscumbia population had a nucleotide diversity of 0.1% in the region containing intron 12 (Table 5). The self-incompatible Waco population had a significantly higher nucleotide diversity compared to both self-compatible populations within introns 13–15 (G(0) = 3.177, P = 0.027) and within intron 12 when compared to the Tuscumbia (G(0) = 2.372, P = 0.041) and Morgan population, respectively (G(0) = 2.864, P = 0.034).


View this table:
[in this window]
[in a new window]
 
Table 5. Nucleotide variation in introns of PgiC within self-incompatible and self-compatible populations of Leavenworthia alabamica. Mating system denotes whether populations are self-incompatible (SI) or self-compatible (SC)

 
In the sequence analysis within the self-incompatible Waco population, I found 11 and 10 haplotypes within introns 12 and introns 13–15, respectively. In contrast, the self-compatible Morgan population has a single intron 12 haplotype that is quite frequent in the self-incompatible Waco population (Table 6). The self-compatible Tuscumbia population possesses the same intron 12 haplotype at a relatively high frequency, but possesses two rare and unique haplotypes in this region. Both of the self-compatible populations were monomorphic for unique haplotypes in the region spanning introns 13–15 (Table 6). In all of the populations, the results of Tajima's tests of neutrality in both regions did not suggest recent changes in effective population size (Table 5). However, the power of this test to detect changes in population size is limited by the low number of polymorphisms observed in self-compatible populations of L. alabamica (Tajima, 1989a , b ).


View this table:
[in this window]
[in a new window]
 
Table 6. Haplotype structure in populations of L. alabamica. Haplotypes within intron 12 and introns 13–15 were identified through independent investigation. A period (‘.’) denotes nucleotide identity with the topmost haplotype in a region. Nucleotide substitutions are denoted by alternate bases, and insertions (i) and deletions (d) are also shown. Frequencies represent the relative abundance of haplotypes within each population

 
DISCUSSION

The pattern of pollen limitation in the reciprocal-transplant experiment is not consistent with the hypothesis that pollinator limitation has favored the evolution of self-compatibility in L. alabamica. Pollen limitation of seed set appears to be relatively uniform across the geographical range of this species and unrelated to the appearance of self-compatible races with adaptations for self-fertilization. The spread of alleles conferring self-compatibility is likely driven by other ecological factors that limit population size, plant density, or pollen availability at the margins of the Moulton Valley.

Geographic variation in mating system
Self-incompatibility within the a1 race is caused by single-locus sporophytic self-incompatibility, which has been observed throughout the Brassicaceae and has also been shown to be the ancestral mating system in the genus Leavenworthia (Rollins, 1963 ; Lloyd, 1967 ; J. Beck, I. Al-Shehbaz, and B. Schaal, Washington University, unpublished data). Although alleles conferring self-compatibility are likely present at low frequency in central populations, natural selection has not caused their spread and fixation. Because complex genetically controlled self-incompatibility systems in plants are more easily lost through mutation than they are gained (Barrett et al., 1996 ; Kohn et al., 1996 ), it is likely that self-compatibility has evolved from the self-incompatible condition at the periphery of the species' range. The existence of two reproductive modes in L. alabamica also suggests that the loss of the sporophytic self-incompatibility mechanism and subsequent adaptations to self-fertilization may have occurred relatively recently. In support of this idea, a selective sweep favoring self-compatibility in Arabidopsis thaliana has likely occurred in the last 17 000 years, suggesting that floral adaptations to self-fertilization may evolve rapidly in the Brassicaceae (Shimizu et al., 2004 ).

The self-compatible races exhibit varying degrees of floral adaptation to autonomous self-fertilization. The a2 race has relatively large flowers, extrorse anthers, and an intermediate pollen to ovule ratio, whereas the remaining races (a4, Russellville and Tuscumbia) have the smallest flowers with introrse anthers and low pollen to ovule ratios. Once the genetically controlled self-incompatibility system was dissolved in peripheral populations of L. alabamica, natural selection likely favored adaptations for self-fertilization and reductions in the investment in traits that serve to attract pollinators (Cruden, 1977 ; Charlesworth and Charlesworth, 1981 ; Schueller, 2004 ). The retention of extrorse anthers and relatively large flowers in race a2 suggests that self-compatibility has evolved recently in this race or that it periodically experiences gene flow with the nearby self-incompatible populations (Lloyd, 1965 ). These results support findings in other systems of variation among recently derived self-compatible populations in their adaptations to autonomous self-fertilization (Rick et al., 1977 , 1979 ; Barrett and Shore, 1987 ; Husband and Barrett, 1993 ; Johnston and Schoen, 1996 ).

Pollen limitation of seed production
In comparison to self-incompatible plants, self-compatible plants had consistently higher fruit and seed set in all environments. These results are counter to the hypothesis that reduced visitation by native pollinators may drive the evolution of self-fertilization at the periphery of the Moulton Valley in L. alabamica (Lloyd, 1965 ). Although pollen limitation of seed set has been documented in many flowering plant species (Burd, 1994 ), few studies have tested the hypothesis that pollinator limitation selectively favors self-compatible or self-fertilizing plants (Inoue et al., 1996 ; Fausto et al., 2001 ; Goodwillie, 2001 ; Herrera et al., 2001 ; Elle and Carney, 2003 ; Schueller, 2004 ). Results from studies have supported the hypothesis that self-fertilization allows plants to produce extra seed when pollinator activity is low (Inoue et al., 1996 ; Fausto et al., 2001 ; Goodwillie, 2001 ; Elle and Carney, 2003 ; Davis and Delph, 2005 ), though other attempts have not found support for the idea that pollinator limitation drives the evolution of autonomous self-fertilization (Leclerc-Potvin and Ritland, 1994 ; Klips and Snow, 1997 ; Eckert and Schaefer, 1998 ; Herrera et al., 2001 ; Schueller, 2004 ).

It is possible that natural selection favors self-compatibility in peripheral environments during years of low pollinator activity, which would require multiple seasons of study to detect (Piper et al., 1986 ; Burd, 1994 ; Goodwillie, 2001 ; Herrera et al., 2001 ; Kalisz et al., 2004 ; Schueller, 2004 ). Based on the results of this experiment in a single year, self-incompatible genotypes experienced some pollen limitation of seed set in all environments. These results are perhaps not too surprising because this winter annual flowers during the cold temperatures of March and April, when the foraging activity of their insect pollinators may be limited (Rollins, 1963 ). The fact that self-compatibility becomes established in peripheral environments is most likely explained by the fact that reductions in population size or density may further limit seed production in a species with genetically controlled self-incompatibility (Byers and Meagher, 1992 ; Reinartz and Les, 1994 ; Fischer et al., 2003 ). Reductions in plant density may be particularly pronounced at the periphery of the Moulton Valley where the environment is less suitable for the growth of Leavenworthia. In support of this idea, the two highly self-compatible populations belonging to the a4 race became extinct during the period of study (J. Busch, personal observation). Catastrophic declines in population size have also been implicated in the evolution of self-pollination in Clarkia xantiana, an annual plant endemic to the woodlands in the Sierra Nevada foothills (Moore and Lewis, 1965 ; Fausto et al., 2001 ; Moeller and Geber, 2005 ).

Self-compatibility and sequence diversity
If peripheral populations have been small for long periods of time or undergo frequent bottlenecks in size, then these populations should be genetically depauperate. In this study, a self-incompatible population exhibited relatively high nucleotide diversity (1.1% < {pi} < 1.8%), whereas two self-compatible populations maintained much less genetic variation (0 < {pi} < 0.1%). Since geographically central and peripheral populations of L. alabamica simultaneously differ in size, persistence, and the maintenance of self-incompatibility, it is hard to attribute reductions in sequence diversity within the self-compatible populations to the effects of small size per se or increased rates of self-fertilization (Schoen et al., 1996 ; Ingvarsson, 2002 ). Nevertheless, the nearly complete loss of genetic variation in self-compatible populations of L. alabamica supports results from other studies that have compared genetic diversity in closely related self-incompatible and self-compatible taxa (Rick et al., 1977 , 1979 ; Hamrick and Godt, 1996 ; Savolainen et al., 2000 ; Charlesworth, 2003 ).

Sequence diversities within the one self-incompatible and two self-compatible populations in this experiment are consistent with previous work on the intron 12 region of PgiC in the genus Leavenworthia (Filatov and Charlesworth, 1999 ; Liu et al., 1999 ). The species L. crassa, which is the sister taxon of L. alabamica, displays similar variation among populations in the presence or absence of sporophytic self-incompatibility (Lloyd, 1965 , 1967 ). Nucleotide diversities in self-incompatible populations of L. crassa range from 0.5 to 1%, whereas three highly self-compatible populations were completely monomorphic at intron 12 (Liu et al., 1999 ). Analyses of intron variation over a broad 2.3-kb region of the PgiC gene in the self-incompatible species L. stylosa found evidence of long-term balancing selection, and relatively high nucleotide diversity near 5% (Filatov and Charlesworth, 1999 ). In contrast, the close self-compatible relatives L. torulosa and L. uniflora lack any within-population variation within intron 12 of PgiC (Liu et al., 1999 ). These results suggest that the multiple independent derivations of self-compatibility in the genus Leavenworthia are all associated with nearly complete reductions in sequence diversity within populations (Innan and Tajima, 2002 ; Charlesworth, 2003 ).

Conclusions
There has long been interest in understanding the ecological factors that favor the evolution of self-compatibility and adaptations to self-fertilization (Darwin, 1876 ; Stebbins, 1974 ), which is perhaps the most common transition observed in plants (Barrett et al., 1996 ; Kohn et al., 1996 ; Schoen et al., 1997 ; Barrett, 2002 ). One recurring theme in the evolution of inbreeding in plants is the association between isolated, marginal, island, or pollinator-poor environments with self-compatible mating systems (Baker, 1955 , 1967 ; Lloyd, 1980 ; Schueller, 2004 ; Herlihy and Eckert, 2005 ). The results of this study suggest that consistent pollen limitation of seed set favors self-compatible genotypes in all populations of L. alabamica. Although self-compatibility is selectively favored in all environments, this mode of reproduction appears to invade and spread to high frequency only in peripheral and ecologically marginal environments, which support fewer individuals. These results support the idea that decreased population size or abundance in peripheral, island, or isolated environments may strongly favor the dissolution of genetically controlled self-incompatibility systems in flowering plants (Baker, 1955 , 1967 ; Schoen and Brown, 1991 ; Pannell and Barrett, 1998 ).

FOOTNOTES

1 The author thanks L. Delph for discussion and advice. Comments from D. Bell, Y. Brandvain, M. Brothers, C. Herlihy, D. Schoen, J. Steven, and two anonymous reviewers significantly improved the presentation of ideas in this manuscript. I. Anderson helped locate populations during the spring of 2002 and assisted in the reciprocal-transplant experiment. J. Gillece and E. Osnas helped collect data in the field, and O. Grissom, R. Hardin, and E. Speck allowed experiments to be conducted on their private property. The author thanks L. Washington for conducting sequencing reactions and D. Charlesworth, M. Neiman, C. Saintagne, and I. Scotti for advice and technical help with molecular work. Funding was provided by the Indiana Academy of Sciences, Indiana University, NSF, Sigma Xi, and NSF grant DEB-0075318 to L. Delph. Back

2 (e-mail: jbusch{at}bio.indiana.edu ), present address: Department of Biology, McGill University, 1205 Docteur Penfield, Montreal, Quebec, Canada H3A 1B1 Back

LITERATURE CITED

Baker H. G. 1955 Self-compatibility and establishment after "long-distance" dispersal. Evolution 9: 347-348[CrossRef][Web of Science]

Baker H. G. 1967 Support for Baker's law—as a rule. Evolution 21: 853-856[CrossRef][Web of Science]

Barrett S. C. H. 2002 The evolution of plant sexual diversity. Nature Genetics 3: 274-284[CrossRef][Web of Science][Medline]

Barrett S. C. H. L. D. Harder A. C. Worley 1996 The comparative biology of pollination and mating in flowering plants. Philosophical Transactions of the Royal Society of London, B, Biological Sciences 351: 1271-1280[CrossRef]

Barrett S. C. H. M. T. Morgan B. C. Husband 1989 The dissolution of a complex genetic polymorphism: the evolution of self-fertilization in tristylous Eichhornia paniculata (Pontedericaceae). Evolution 43: 1398-1416[CrossRef][Web of Science]

Barrett S. C. H. J. S. Shore 1987 Variation and evolution of breeding systems in the Turnera ulmifolia L. complex (Turneraceae). Evolution 41: 340-354[CrossRef][Web of Science]

Baskin J. M. D. H. Webb C. C. Baskin 1995 A floristic plant ecology study of the limestone glades of northern Alabama. Bulletin of the Torrey Botanical Club 122: 226-242[CrossRef][Web of Science]

Bateman A. J. 1955 Self-incompatibility systems in Angiosperms. III. Cruciferae. Heredity 9: 53-68

Brown J. H. 1984 On the relationship between abundance and distribution of species. American Naturalist 124: 255-279[CrossRef][Web of Science]

Burd M. 1994 Bateman's principle and plant reproduction: the role of pollen limitation in fruit and seed set. Botanical Review 60: 83-139[CrossRef][Web of Science]

Busch J. W. 2005 Inbreeding depression in self-incompatible and self-compatible populations of Leavenworthia alabamica. Heredity 94: 159-165[CrossRef][Web of Science][Medline]

Byers D. L. T. R. Meagher 1992 Mate availiability in small populations of plants with homomorphic self-incompatibility. Heredity 68: 353-359[Web of Science]

Charlesworth D. 2003 Effects of inbreeding on the genetic diversity of populations. Philosophical Transactions of the Royal Society of London, B, Biological Sciences 358: 1051-1070[CrossRef]

Charlesworth D. B. Charlesworth 1981 Allocation of resources to male and female functions in hermaphrodites. Biological Journal of the Linnaean Society 15: 57-74

Charlesworth D. Z. Yang 1998 Allozyme diversity in Leavenworthia populations with different inbreeding levels. Heredity 81: 453-461

Cruden R. W. 1977 Pollen–ovule ratios: a conservative indicator of breeding system in flowering plants. Evolution 31: 32-46

Darwin C. 1876 The effects of cross- and self-fertilization in the vegetable kingdom. John Murray, London, UK

Davis S. L. L. F. Delph 2005 Prior selfing and gynomonoecy in Silene noctiflora L. (Caryophyllaceae): opportunities for enhanced outcrossing and reproductive assurance. International Journal of Plant Sciences: in press

Eckert C. G. S. C. H. Barrett 1992 Stochastic loss of style morphs from populations of tristylous Lythrum salicaria and Decodon verticillatus (Lythraceae). Evolution 46: 1014-1029[CrossRef][Web of Science]

Eckert C. G. A. Schaefer 1998 Does self-pollination provide reproductive assurance in Aquilegia canadensis (Ranunculaceae)?. American Journal of Botany 85: 919-924[Abstract]

Elle E. R. Carney 2003 Reproductive assurance varies with flower size in Collinsia parviflora (Scrophulariaceae). American Journal of Botany 90: 888-896[Abstract/Free Full Text]

Fausto J. A. Jr. V. M. Eckhart M. A. Geber 2001 Reproductive assurance and the evolutionary ecology of self-pollination in Clarkia xantiana (Onagraceae). American Journal of Botany 88: 1794-1800[Abstract/Free Full Text]

Filatov D. A. D. Charlesworth 1999 DNA polymorphism, haplotype structure, and balancing selection in the Leavenworthia PgiC locus. Genetics 153: 1423-1434[Abstract/Free Full Text]

Fischer M. M. Hock M. Paschke 2003 Low genetic variation reduces cross-compatibility and offspring fitness in populations of a narrow endemic plant with a self-incompatibility system. Conservation Genetics 4: 325-336[CrossRef][Web of Science]

Goodwillie C. 2001 Pollen limitation and the evolution of self-compatibility in Linanthus (Polemoniaceae). International Journal of Plant Sciences 162: 1283-1292[CrossRef][Web of Science]

Hamrick J. L. M. J. W. Godt 1996 Effects of life history traits on genetic diversity in plant populations. Philosophical Transactions of the Royal Society of London, B, Biological Sciences 351: 1291-1298[CrossRef]

Herlihy C. R. C. G. Eckert 2002 Genetic cost of reproductive assurance in a self-fertilizing plant. Nature 416: 320-323[CrossRef][Medline]

Herlihy C. R. C. G. Eckert 2005 Evolution of self-fertilization at geographical range margins? A comparison of demographic, floral, and mating system variables in central vs. peripheral populations of Aquilegia canadensis (Ranunculaceae). American Journal of Botany 92: 744-751[Abstract/Free Full Text]

Herrera C. M. A. M. Sanchez-Lafuente M. Medrano J. Guitian X. Cedra P. Rey 2001 Geographical variation in autonomous self-pollination levels unrelated to pollinator service in Helleborus foetidus (Ranunculaceae). American Journal of Botany 88: 1025-1032[Abstract/Free Full Text]

Husband B. C. S. C. H. Barrett 1993 Multiple origins of self-fertilization in tristylous Eichornia paniculata (Pontederiaceae): inferences from style morph and isozyme variation. Journal of Evolutionary Biology 6: 591-608[CrossRef][Web of Science]

Ingvarsson P. K. 2002 A metapopulation perspective on genetic diversity and differentiation in partially self-fertilizing plants. Evolution 56: 2368-2373[CrossRef][Web of Science][Medline]

Innan H. F. Tajima 2002 A statistical test for the difference in the amounts of DNA variation between two populations. Genetical Research 80: 15-25[CrossRef][Web of Science][Medline]

Inoue K. M. Maki M. Masuda 1996 Evolution of Campanula flowers in relation to insect pollinators on islands. In D. G. Lloyd and S. C. H. Barrett [eds.], Floral biology: studies on floral evolution in animal-pollinated plants, 377–401. Chapman and Hall, New York, New York, USA

Jain S. K. 1976 The evolution of inbreeding in plants. Annual Review of Ecology and Systematics 7: 469-495

Johnston D. W. Jr. 1930 Physical divisions of northern Alabama. Geological Survey of Alabama Bulletin 38: 1-48

Johnston M. O. D. J. Schoen 1996 Correlated evolution of self-fertilization and inbreeding depression: an experimental study of nine populations of Amsinckia (Boraginaceae). Evolution 50: 1478-1491[CrossRef][Web of Science]

Kalisz S. D. W. Vogler K. M. Hanley 2004 Context-dependent autonomous self-fertilization yields reproductive assurance and mixed mating. Nature 430: 884-886[CrossRef][Medline]

Kearns C. A. D. W. Inouye 1993 Techniques for pollination biologists. University Press of Colorado, Niwot, Colorado, USA

Klips R. A. A. A. Snow 1997 Delayed autonomous self-pollination in Hibiscus laevis (Malvaceae). American Journal of Botany 84: 48-53[Abstract]

Kohn J. R. S. W. Graham B. Morton J. J. Doyle S. C. H. Barrett 1996 Reconstruction of the evolution of reproductive characters in Pontederiaceae using phylogenetic evidence from chloroplast DNA restriction-site variation. Evolution 50: 1454-1469[CrossRef][Web of Science]

Krebs C. J. 1999 Ecological methodology, 2nd ed. Addison Wesley Longman, Menlo Park, California, USA

Leclerc-Potvin C. K. Ritland 1994 Modes of self-fertilization in Mimulus guttatus (Scrophulariaceae): a field experiment. American Journal of Botany 81: 199-205[CrossRef][Web of Science]

Levin D. A. 1996 The evolutionary significance of pseudo-self-fertility. American Naturalist 148: 321-332[CrossRef][Web of Science]

Liu F. D. Charlesworth M. Kreitman 1999 The effect of mating system differences on nucleotide diversity at the phosphoglucose isomerase locus in the plant genus Leavenworthia. Genetics 151: 343-357[Abstract/Free Full Text]

Lloyd D. G. 1965 Evolution of self-compatibility and racial differentiation in Leavenworthia (Cruciferae). Contributions from the Gray Herbarium of Harvard University 195: 3-134

Lloyd D. G. 1967 The genetics of self-incompatibility in Leavenworthia crassa Rollins (Cruciferae). Genetica 38: 227-242[CrossRef][Web of Science]

Lloyd D. G. 1979 Some reproductive factors affecting the selection of self-fertilization in plants. American Naturalist 113: 67-79[CrossRef][Web of Science]

Lloyd D. G. 1980 Demographic factors and mating patterns in angiosperms. In O. T. Solbrig [ed.], Demography and evolution in plant populations, 67–88. University of California Press, Berkeley, California, USA

Lloyd D. G. 1992 Self- and cross-fertilization in plants. II. The selection of self-fertilization. International Journal of Plant Sciences 153: 370-380[CrossRef]

Lyons E. E. J. Antonovics 1991 Breeding system evolution in Leavenworthia—breeding system variation and reproductive success in natural populations of Leavenworthia crassa (Cruciferae). American Journal of Botany 78: 270-287[CrossRef][Web of Science]

Moeller D. A. M. A. Geber 2005 Ecological context of the evolution of self-pollination in Clarkia xantiana: population size, plant communities, and reproductive assurance. Evolution 59: 786-799[Web of Science][Medline]

Moore D. M. H. Lewis 1965 The evolution of self-pollination in Clarkia xantiana. Evolution 19: 104-114[CrossRef][Web of Science]

Niu T. Z. S. Qin X. Xu J. Liu 2002 Bayesian haplotype inference for multiple linked single-nucleotide polymorphisms. American Journal of Human Genetics 70: 157-169[CrossRef][Web of Science][Medline]

Pannell J. R. S. C. H. Barrett 1998 Baker's law revisited: reproductive assurance in a metapopulation. Evolution 52: 657-668[CrossRef][Web of Science]

Piper J. G. B. Charlesworth D. Charlesworth 1986 Breeding system evolution in Primula vulgaris and the role of reproductive assurance. Heredity 56: 207-217[Web of Science]

Reinartz J. A. D. H. Les 1994 Bottleneck-induced dissolution of self-incompatibility and breeding system consequences in Aster furcatus (Asteraceae). American Journal of Botany 81: 446-455[CrossRef][Web of Science]

Rick C. M. J. F. Fobes M. Holle 1977 Genetic variation in Lycopersicon pimpinellifolium: evidence of evolutionary change in mating systems. Plant Systematics and Evolution 127: 139-170[CrossRef][Web of Science]

Rick C. M. J. F. Fobes S. D. Tanksley 1979 Evolution of mating systems in Lycopersicon hirsutum as deduced from genetic variation in electrophoretic and morphological characters. Plant Systematics and Evolution 132: 279-298[CrossRef][Web of Science]

Rollins R. C. 1963 The evolution and systematics of Leavenworthia (Cruciferae). Contributions from the Gray Herbarium of Harvard University 192: 3-98

Rozas J. J. C. Sanchez-Delbarrio X. Messeguer R. Rozas 2003 DNAsp, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19: 2496-2497[Abstract/Free Full Text]

Sagarin R. D. S. D. Gaines 2002 The ‘abundant centre’ distribution: to what extent is it a biogeographical rule?. Ecology Letters 5: 137-147

Savolainen O. C. H. Langley B. P. Lazzaro H. Freville 2000 Contrasting patterns of nucleotide polymorphism at the alcohol dehydrogenase locus in the outcrossing Arabidopsis lyrata and the selfing Arabidopsis thaliana. Molecular Biology and Evolution 17: 645-655[Abstract/Free Full Text]

Schoen D. J. A. H. D. Brown 1991 Interspecific variation in population gene diversity and effective population size correlates with the mating system in plants. Proceedings of the National Academy of Sciences, USA 88: 4494-4497[Abstract/Free Full Text]

Schoen D. J. M. O. Johnston A. L'Hereux J. V. Marsolais 1997 Evolutionary history of the mating system in Amsinckia (Boraginaceae). Evolution 51: 1090-1099[CrossRef][Web of Science]

Schoen D. J. M. T. Morgan T. Bataillon 1996 How does self-pollination evolve? Inferences from floral ecology and molecular genetic variation. Philosophical Transactions of the Royal Society of London, B, Biological Sciences 351: 1281-1290[CrossRef]

Schueller S. K. 2004 Self-pollination in island and mainland populations of the introduced hummingbird-pollinated plant, Nicotiana glauca (Solanaceae). American Journal of Botany 91: 672-681[Abstract/Free Full Text]

Shimizu K. K. J. M. Cork A. L. Caicedo C. A. Mays R. C. Moore K. M. Olsen S. Ruzsa G. Coop C. D. Bustamante P. Awadalla M. D. Purugganan 2004 Darwinian selection on a selfing locus. Science 306: 2081-2084[Abstract/Free Full Text]

Sokal R. F. J. Rohlf 1995 Biometry, 3rd ed. Freeman, New York, New York, USA

Solbrig O. T. R. C. Rollins 1977 Evolution of autogamy in species of the mustard genus Leavenworthia. Evolution 31: 265-281[CrossRef][Web of Science]

Stebbins G. L. 1957 Self-fertilization and population variability in the higher plants. American Naturalist 91: 337-354[CrossRef][Web of Science]

Stebbins G. L. 1974 Flowering plants: evolution above the species level. Belknap Press of Harvard University, Cambridge, Massachusetts, USA

Tajima F. 1989a Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123: 585-595[Abstract/Free Full Text]

Tajima F. 1989b The effect of a change in population size on DNA polymorphism. Genetics 123: 597-601[Abstract/Free Full Text]

Takebayashi N. P. L. Morrell 2001 Is self-fertilization an evolutionary dead end? Revisiting an old hypothesis with genetic theories and a macroevolutionary approach. American Journal of Botany 88: 1143-1150[Abstract/Free Full Text]

Wright S. 1964 The distribution of self-incompatibility alleles in populations. Evolution 18: 609-619[CrossRef][Web of Science]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
ANN BOT (LOND)Home page
K. J. Duffy, G. Scopece, S. Cozzolino, M. F. Fay, R. J. Smith, and J. C. Stout
Ecology and genetic diversity of the dense-flowered orchid, Neotinea maculata, at the centre and edge of its range
Ann. Bot., August 1, 2009; 104(3): 507 - 516.
[Abstract] [Full Text] [PDF]


Home page
ANN BOT (LOND)Home page
G. D. Holmes, E. A. James, and A. A. Hoffmann
Limitations to Reproductive Output and Genetic Rescue in Populations of the Rare Shrub Grevillea repens (Proteaceae)
Ann. Bot., December 1, 2008; 102(6): 1031 - 1041.
[Abstract] [Full Text] [PDF]


Home page
ANN BOT (LOND)Home page
A. V. Etcheverry, M. M. Aleman, and T. F. Fleming
Flower Morphology, Pollination Biology and Mating System of the Complex Flower of Vigna caracalla (Fabaceae: Papilionoideae)
Ann. Bot., September 1, 2008; 102(3): 305 - 316.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
S. Kubota, Y. Kameyama, A. S. Hirao, and M. Ohara
Adaptive significance of self-fertilization in a hermaphroditic perennial, Trillium camschatcense (Melanthiaceae)
Am. J. Botany, April 1, 2008; 95(4): 482 - 489.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. W. Busch, J. Sharma, and D. J. Schoen
Molecular Characterization of Lal2, an SRK-Like Gene Linked to the S-Locus in the Wild Mustard Leavenworthia alabamica
Genetics, April 1, 2008; 178(4): 2055 - 2067.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. I. Mena-Ali and A. G. Stephenson
Segregation Analyses of Partial Self-Incompatibility in Self and Cross Progeny of Solanum carolinense Reveal a Leaky S-Allele
Genetics, September 1, 2007; 177(1): 501 - 510.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
M. Mimura and S. N. Aitken
Increased selfing and decreased effective pollen donor number in peripheral relative to central populations in Picea sitchensis (Pinaceae)
Am. J. Botany, June 1, 2007; 94(6): 991 - 998.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
C. L. Gross and H. A. R. Caddy
Are differences in breeding mechanisms and fertility among populations contributing to rarity in Grevillea rhizomatosa (Proteaceae)?
Am. J. Botany, December 1, 2006; 93(12): 1791 - 1799.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
I. A. Anderson and J. W. Busch
Relaxed pollinator-mediated selection weakens floral integration in self-compatible taxa of Leavenworthia (Brassicaceae)
Am. J. Botany, June 1, 2006; 93(6): 860 - 867.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (25)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Busch, J. W.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Busch, J. W.
Agricola
Right arrow Articles by Busch, J. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS