| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Reproductive Biology |
Department of Biology, Indiana University, 1001 E. 3rd St., Bloomington, Indiana 47405 USA
Received for publication December 17, 2004. Accepted for publication June 15, 2005.
ABSTRACT
Self-compatibility and adaptations to self-fertilization are often found in plant populations at the periphery of species' ranges or on islands. Self-compatibility may predominate in these environments because it provides reproductive assurance when pollinators or availability of mates limits seed production. This possibility was studied in Leavenworthia alabamica, a flowering plant endemic to the southeastern United States. Populations at the center of the species' range retain sporophytic self-incompatibility, but peripheral populations are smaller, self-compatible, and have adaptations for self-fertilization. A reciprocal-transplant experiment was designed to test whether there is pollen limitation of seed set and to examine its strength in central and peripheral populations. Self-compatible genotypes produced more fruit and 17–22% more seed than self-incompatible genotypes in all environments, suggesting that the transition to self-compatibility may be favored by natural selection in all populations inhabited by L. alabamica. Sequence analyses demonstrated that two peripheral populations have 90–100% reductions in genetic variation, consistent with the effects of small population size or historical bottlenecks. Although pollen limitation of seed set occurs in all environments, self-compatibility may evolve at the periphery in L. alabamica because the benefits of reproductive assurance are influenced by population size or bottlenecks following extinction and colonization.
Key Words: Baker's law • Brassicaceae • cedar glades • inbreeding • mating system • pollen limitation • reproductive assurance • self-incompatibility
The evolution of self-fertilization from outcrossing is one of the most common evolutionary transitions in plants and has occurred in many taxonomic groups (Stebbins, 1974
; Barrett and Shore, 1987
; Barrett et al., 1989
; Barrett et al., 1996
; Kohn et al., 1996
; Schoen et al., 1997
; Takebayashi and Morrell, 2001
; Barrett, 2002
). One recurring theme is the association of peripheral, isolated, and island environments with self-compatible mating systems (Baker, 1955
, 1967
; Stebbins, 1957
; Lloyd, 1980
; Barrett and Shore, 1987
; Inoue et al., 1996
; Schueller, 2004
; Herlihy and Eckert, 2005
). Self-compatibility may be restricted to these portions of species' ranges because of lower environmental quality (Brown, 1984
; Sagarin and Gaines, 2002
), such that pollinators or conspecific plants become scarce. If reduced pollinator activity or plant density causes pollen limitation of seed set in these peripheral environments, alleles conferring self-compatibility will spread within populations because the capacity to self-fertilize provides reproductive assurance (Moore and Lewis, 1965
; Jain, 1976
; Lloyd, 1979
, 1992
).
Darwin (1876)
was the first to suggest that inadequate pollinator service would favor the evolution of autonomous seed production by natural selection. This hypothesis for the evolution of self-fertilization has recently been tested in a variety of empirical systems (Barrett et al., 1998; Eckert and Schaefer, 1998
; Fausto et al., 2001
; Herrera et al., 2001
; Herlihy and Eckert, 2002
; Elle and Carney, 2003
; Kalisz et al., 2004
; Schueller, 2004
). Investigators have either examined the effects of natural variation in pollinator availability on pollen limitation of seed set (Fausto et al., 2001
; Herrera et al., 2001
; Kalisz et al., 2004
; Schueller, 2004
; Moeller and Geber, 2005
) or have experimentally manipulated the ability of plants to autonomously self-fertilize (Leclerc-Potvin and Ritland, 1994
; Klips and Snow, 1997
; Eckert and Schaefer, 1998
; Herlihy and Eckert, 2002
; Davis and Delph, 2005
). Empirical attempts to test pollinator limitation must demonstrate either that (1) patterns of reduced pollinator visitation correlate with selection for self-fertilization in nature (Inoue et al., 1996
; Fausto et al., 2001
; Elle and Carney, 2003
; Kalisz et al., 2004
); or (2) individuals lacking the ability to autonomously self-fertilize produce fewer seeds (Leclerc-Potvin and Ritland, 1994
; Klips and Snow, 1997
; Eckert and Schaefer, 1998
; Herrera et al., 2001
; Herlihy and Eckert, 2002
; Elle and Carney, 2003
; Schueller, 2004
; Davis and Delph, 2005
).
Reproductive assurance and the benefits of self-compatibility may also be strongly influenced by plant density or population size (Baker, 1955
, 1967
). Bottlenecks during the founding of new populations could strongly favor self-compatibility and explain the preponderance of self-compatible species on islands or in isolated regions of the species' range (Stebbins, 1957
; Lloyd, 1980
; Barrett et al., 1989
; Inoue et al., 1996
; Schueller, 2004
). In species with genetically controlled self-incompatibility systems, reductions in plant density may dramatically limit the reproductive success of individuals, since low S-allele diversity can obviate the production of offspring through outcrossing (Wright, 1964
; Byers and Meagher, 1992
; Reinartz and Les, 1994
; Pannell and Barrett, 1998
; Fischer et al., 2003
). In support of this idea, numerous researchers have shown that historical colonization and low plant density may favor the evolution of self-compatibility, although pollinator limitation likely also plays a role (Lloyd, 1980
; Barrett et al., 1989
; Eckert and Barrett, 1992
; Schueller, 2004
; Moeller and Geber, 2005
).
Species of Leavenworthia are excellent candidates for the study of the ecological factors favoring the evolution of self-compatibility. A history of work in Leavenworthia suggests that selection for reproductive assurance has likely led to the independent evolution of self-compatibility four times among the eight extant species (Rollins, 1963
; Lloyd, 1965
; Solbrig and Rollins, 1977
; Lyons and Antonovics, 1991
). Single-locus, sporophytic self-incompatibility is found throughout the Brassicaceae (Bateman, 1955), is the ancestral mating system in the genus Leavenworthia (Lloyd, 1967
; J. Beck, I. Al-Shehbaz, and B. Schaal, Washington University, unpublished data) and is absent in some populations of L. alabamica (Lloyd, 1965
; Busch, 2005
). This species is endemic to the Moulton Valley, a region in northern Alabama that is approximately 96 km long in an east–west direction and 5–16 km wide (Johnston, 1930
). Differentiation among L. alabamica populations in self-compatibility, floral adaptations for self-fertilization, and vegetative morphology has led to their recognition as distinct land races (Lloyd, 1965
). Previous work in this system has shown that populations at the center of the species' range are primarily composed of self-incompatible plants, whereas peripheral sites harbor many self-compatible plants (Map 1 in Lloyd, 1965
). Self-compatible populations are thought to be highly self-fertilizing because flowers readily produce seed autonomously, lack spatial separation of the anthers and stigma, and possess many adaptations for self-pollination such as introrse anthers, short petals, short styles, and low pollen to ovule ratios (Rollins, 1963
; Lloyd, 1965
).
The narrow Moulton Valley of northern Alabama is composed of a rocky bed of limestone that is covered with an extremely thin layer of moist soil (Baskin et al., 1995
). In such cedar glades, L. alabamica grows and is visited by several species of solitary bees (Andrena spp. and Halictus ligatus), which vigorously climb over the central comb containing the stigma and anthers (Lloyd, 1965
). At the periphery of the Moulton Valley, the elevation rises 75 m on the Cumberland Plateau to the south and the Highland Rim to the north (Johnston, 1930
). These changes in elevation are also associated with reductions in soil moisture and the availability of exposed rock. At the periphery of the species' range, cedar glades are smaller and more disturbed, populations are less dense, and from historical observations, native pollinators appear less common (Lloyd, 1965
). All these factors may act in concert to selectively favor self-compatibility at the border of the Moulton Valley.
If the availability or activity of pollinators declines in peripheral populations of L. alabamica, then pollen limitation of seed set should be greater in these environments (Herrera et al., 2001
; Schueller, 2004
). If this hypothesis is true, self-compatible genotypes should produce more seed than self-incompatible genotypes, and this difference should be greatest in peripheral environments. If this hypothesis is not supported, then the evolution of self-compatibility in peripheral environments may be attributed to other ecological forces limiting pollen availability, such as small population size, low plant density, or reduced S-allele diversity (Byers and Meagher, 1992
; Reinartz and Les, 1994
; Pannell and Barrett, 1998
; Fischer et al., 2003
). In a reciprocal-transplant experiment, I tested the idea that pollen limitation of seed set is higher at the periphery of the species' range. Sequence diversity was analyzed in one self-incompatible and two peripheral self-compatible populations to determine if patterns of genetic variation were consistent with the role of small population size or historical bottlenecks in peripheral environments.
MATERIALS AND METHODS
Variation in self-compatibility
Leavenworthia alabamica Rollins (Alabama glade cress; Brassicaceae) is a winter annual, endemic to the limestone cedar glades of the Moulton Valley in northern Alabama, though a few populations are found in the Tennessee River Valley near Tuscumbia, AL (Rollins, 1963
). Individuals of L. alabamica germinate in the late fall and grow very slowly during the winter months. Vegetative growth accelerates when temperatures warm in the late winter and plants begin to flower in early March. Seeds mature on maternal plants and are passively dispersed throughout late April and early May (Solbrig and Rollins, 1977
). Pollen dispersal between populations is rare because of the small home-range of native bees (Lloyd, 1965
). Gene flow between populations is thought to primarily occur following the dispersal of seeds by intermittent periods of flooding during the spring.
Floral morphology was studied in five self-incompatible populations (Hatton, Isbell, Newburg, Tharptown, and Waco) and five self-compatible populations (Landersville, Lebanon, Morgan/Huckaby Bridge, Russellville, and Tuscumbia; see Busch, 2005
for population locations). Plant density and population size were estimated in March 2003 by counting plants within 30 separate 0.093 m2 quadrats along two linear transects (Krebs, 1999
; Table 1). Seeds were collected from these populations in late April and early May of 2003 and germinated in petri plates during October 2003. Seeds and seedlings were grown according to established protocols (Busch, 2005
) to flowering in an Indiana University greenhouse.
|
). Petal length, pistil height, and the height of the paired stamens on the first or second flower produced by plants were measured to the nearest 0.01 mm. The rotation of the anther sacs on the paired stamens was also scored because this trait likely influences the ability of plants to autonomously self-fertilize (Lloyd, 1965
). The convention of Rollins (1963)
was used to quantify the rotation of the anther sacs away from the pistil according to discrete angles (45°, 90°, 135° or 180°; Lyons and Antonovics, 1991
). All six stamens were carefully removed with forceps, and pollen grains were immersed in 5 mL of a 3 : 1 solution of lactic acid and glycerol and vortexed for 30 s, then 1/1,000th of this solution (5 µL) was placed onto a slide and mixed with 10 µL of Alexander's stain (Kearns and Inouye, 1993
). The total number of pollen grains per flower was then estimated from counts of four replicate samples. Ovule number was counted using a dissecting microscope.
Self-compatibility and the rate of autonomous self-fertilization were measured on each plant. To determine the degree of self-compatibility, 10 newly opened flowers were forcibly self-pollinated on each individual. Each individual's degree of self-compatibility was scored as the fraction of hand-self-pollinated flowers that produced fruit (Charlesworth and Yang, 1998
). The rate of autonomous self-fertilization was scored as the fraction of undisturbed flowers that produced fruit in a pollinator-free greenhouse. Autonomous self-fertilization in this experiment does not exclude the possibility of agamospermy, or the production of seed through asexual reproduction.
Differences between races in floral traits were evaluated with univariate analyses of variance and Tukey's post-hoc comparisons (Sokal and Rohlf, 1995
). To minimize the effect of multiple comparisons, I ran significance tests with an alpha-corrected Bonferroni level of 
= 0.01. The differences among populations within races were limited, so populations were grouped according to their race as originally designated by Lloyd (1965)
.
Reciprocal-transplant experiment
A reciprocal-transplant experiment was conducted using two central and two peripheral sites that support self-incompatible (Isbell, Waco; Table 1) and self-compatible plants (Morgan, Tuscumbia; Table 1), respectively. In December 2003, 250 seedlings from each of four populations were removed from their native sites and placed in flats of soil. Efforts were made to minimize variation among individuals in their number of leaves at the start of the experiment. Approximately 50 individuals from each population were then transplanted into linear transects at each experimental site on 13–15 December and marked with rust-resistant nails. In the early part of March, utility crews planned to destroy the Morgan experimental site. Plants at this site were transplanted 500 meters downstream of the natural drainage, into a site supporting L. alabamica. Plants were watered at this site for 1 week to ensure that they survived transplantation.
During March and April, floral traits associated with autonomous self-fertilization were measured on all experimental plants. The date of flowering was recorded as the first day an individual produced an open flower. Petal length was recorded to the nearest 0.01 mm with digital calipers. The degree of anther rotation was also scored. Differences between self-incompatible and self-compatible genotypes in the afore-mentioned floral traits and time to flowering were evaluated within each site with t tests using a Bonferroni-corrected alpha level of = 0.01. The total number of flowers and fruits produced during the lifetime of plants was measured at the end of the flowering season. The proportion of flowers that produced fruit on each individual plant was then counted at each experimental site. At the end of the flowering season, the aboveground biomass of plants was harvested, placed in bags, and dried in an oven at 50°C for 1 week. The number of matured seeds and aborted seeds per fruit were counted for all fruits and averaged for each individual plant.
Fruit and seed set were measured only on transplanted plants in each population. Separate univariate analyses of variance (ANOVAs) were conducted on these measures of seed production: (1) arcsine square-root transformed fruit set and (2) number of matured seeds per fruit. In both ANOVAs, experimental site and self-incompatibility type (i.e., genotype) were fixed effects, and "days to flowering" was used as a continuously distributed covariate. Populations were pooled according to their self-incompatibility type because these populations were randomly sampled to reflect variation caused by the transition from self-incompatibility to self-compatibility, and the differences between populations were limited. A significant interaction between site and genotype would suggest that the benefits of self-compatibility are environment dependent. Significance tests of the difference between self-incompatible and self-compatible genotypes were conducted using a Tukey's post-hoc test (Sokal and Rohlf, 1995
). In analyses with a significant site by genotype interaction, the differences between self-incompatible and self-compatible genotypes were evaluated separately within each site. A univariate ANOVA was also conducted on the number of aborted seeds per fruit to determine if genotypes differed in their propensity to selectively abort developing offspring.
Sequencing neutral genetic diversity
Species of Leavenworthia possess only a single copy of the cytosolic phosphoglucose isomerase gene (Liu et al., 1999
). Approximately 25 to 30 individuals from one self-incompatible and two self-compatible populations were sampled. Leaves from individual plants were flash frozen with liquid nitrogen, and genomic DNA was extracted using Qiagen DNeasy plant mini kits. An approximately 250-bp region corresponding to intron 12 was amplified using the plus primer AGTATGGCTTCTCCATGGTT (PGIC.P1) and a minus primer ATGTGGACTTGAAATGCTG (PGIC.2PR). Another pair of conserved primers was used to amplify an approximately 650-bp region containing several exons and introns 13, 14, and 15 of PgiC (PGI+14: AGGGAGCTTCAAGCATTGAT; PGI-4: TCGAACGGGAGAGGTAGACCA).
DNA was amplified using the PCR reaction conditions reported for intron 12 and introns 13–15 (Filatov and Charlesworth, 1999
; Liu et al., 1999
). Organic residues were removed from PCR products by using QIAquick PCR purification kits (Qiagen). DNA templates were cycle-sequenced in 10 µL reactions with 0.0002 µg of the forward primer (PGI.P1 or PGI+14), 1 µL v. 3.1 BigDye terminator ready reaction mix (Applied BioSystems, Foster City, California, USA) and 1.5 mM MgCl2. The procedure consisted of 25 cycles each of 30 s at 96°C, 15 s at 50°C, and 4 min at 60°C. The samples were sequenced with an ABI 3730 automated sequencer (Applied Biosystems). Sequences were aligned in Sequencher v. 4.1 (Gene Codes Corp., Ann Arbor, Michigan, USA). Individuals heterozygous at sites of insertion–deletion polymorphisms were excluded from analyses because of the inability to score nucleotides.
Haplotype structure was analyzed using Haplotyper software (Niu et al., 2002
). Ambiguous base calls were corrected manually. The exons found in the region containing introns 13–15 were identified by alignment with an L. crassa mRNA (GenBank accession AF054455) and were removed before further analyses. In some cases, sequencing efforts in intron 12 and introns 13– 15 utilized different individuals, so these regions were analyzed separately. The haplotypes sequenced in intron 12 and introns 13–15 are GenBank accessions AY745782–AY745805. Measures of sequence diversity were estimated using DNAsp v. 4.0.0.4 (Rozas et al., 2003
). The number of segregating sites per site (ps) and the populational heterozygosity, or nucleotide diversity per site (
) were calculated. Insertion-deletion polymorphisms were coded as single nucleotide polymorphisms. The variance in nucleotide diversity was directly estimated by sampling with replacement from the original dataset of sequences 500 times. Nucleotide diversity within populations was statistically compared, assuming that the divergence between populations is recent (Innan and Tajima, 2002
). Tajima's tests were conducted to test the hypothesis that populations are not at equilibrium between mutation and genetic drift (Tajima, 1989a
).
RESULTS
Variation in self-compatibility
Self-incompatible populations of L. alabamica are an order of magnitude larger than self-compatible populations (t = 13.83, df = 8, P = 0.001; Table 1). Although not statistically significant, self-incompatible populations also tend to have higher plant density in comparison to self-compatible populations (t = 1.586, df = 8, P = 0.151; Table 1). Self-incompatible plants produce very few fruits autonomously in the greenhouse (<2% of all flowers) and have large flowers with extrorse anthers and high pollen to ovule to ratios (Table 2). Although the self-incompatibility reaction of the Brassicaceae is leaky, there are discrete differences in its prevalence between the races. Of the 86 plants from the self-incompatible race (a1) measured in the greenhouse, two individuals produced seed more than 80% of the time following self-pollination, whereas the majority of plants accepted self pollen less than 10% of the time. Therefore, the majority of plants sampled from the a1 race are self-incompatible, although there may be a low frequency of alleles conferring self-compatibility in these populations (2/86 = 0.023).
|
).
Reciprocal-transplant experiment
In all field sites, plants transplanted from self-compatible populations produced smaller flowers with more introrse anthers compared to plants transplanted from self-incompatible populations (Fig. 1a, b). In the peripheral site which had to be re-transplanted (Morgan), self-incompatible plants flowered earlier and had higher lifetime flower production in comparison to self-compatible genotypes. There were no significant differences between the genotypes at the remaining sites, which were not watered during the spring (Fig. 1c, d). There was a significant interaction between site and genotype on patterns of fruit set (Table 3). This interaction resulted from self-compatible genotypes having a significantly higher fruit set than self-incompatible genotypes in all sites except the peripheral Tuscumbia site (Fig. 2). There was not a significant interaction between site and genotype on patterns of seed production per fruit (Table 4), with self-compatible plants producing a greater number of seeds per fruit in all environments (Fig. 3). Overall, self-compatible genotypes produced 17–22% more seeds per fruit compared to self-incompatible plants in all environments. Although not statistically significant, there was also a trend for self-compatible plants to abort more seeds per fruit in all sites (F1,479 = 3.422, P = 0.072; Fig. 3).
|
|
|
|
|
|
, b
).
|
The pattern of pollen limitation in the reciprocal-transplant experiment is not consistent with the hypothesis that pollinator limitation has favored the evolution of self-compatibility in L. alabamica. Pollen limitation of seed set appears to be relatively uniform across the geographical range of this species and unrelated to the appearance of self-compatible races with adaptations for self-fertilization. The spread of alleles conferring self-compatibility is likely driven by other ecological factors that limit population size, plant density, or pollen availability at the margins of the Moulton Valley.
Geographic variation in mating system
Self-incompatibility within the a1 race is caused by single-locus sporophytic self-incompatibility, which has been observed throughout the Brassicaceae and has also been shown to be the ancestral mating system in the genus Leavenworthia (Rollins, 1963
; Lloyd, 1967
; J. Beck, I. Al-Shehbaz, and B. Schaal, Washington University, unpublished data). Although alleles conferring self-compatibility are likely present at low frequency in central populations, natural selection has not caused their spread and fixation. Because complex genetically controlled self-incompatibility systems in plants are more easily lost through mutation than they are gained (Barrett et al., 1996
; Kohn et al., 1996
), it is likely that self-compatibility has evolved from the self-incompatible condition at the periphery of the species' range. The existence of two reproductive modes in L. alabamica also suggests that the loss of the sporophytic self-incompatibility mechanism and subsequent adaptations to self-fertilization may have occurred relatively recently. In support of this idea, a selective sweep favoring self-compatibility in Arabidopsis thaliana has likely occurred in the last 17 000 years, suggesting that floral adaptations to self-fertilization may evolve rapidly in the Brassicaceae (Shimizu et al., 2004
).
The self-compatible races exhibit varying degrees of floral adaptation to autonomous self-fertilization. The a2 race has relatively large flowers, extrorse anthers, and an intermediate pollen to ovule ratio, whereas the remaining races (a4, Russellville and Tuscumbia) have the smallest flowers with introrse anthers and low pollen to ovule ratios. Once the genetically controlled self-incompatibility system was dissolved in peripheral populations of L. alabamica, natural selection likely favored adaptations for self-fertilization and reductions in the investment in traits that serve to attract pollinators (Cruden, 1977
; Charlesworth and Charlesworth, 1981
; Schueller, 2004
). The retention of extrorse anthers and relatively large flowers in race a2 suggests that self-compatibility has evolved recently in this race or that it periodically experiences gene flow with the nearby self-incompatible populations (Lloyd, 1965
). These results support findings in other systems of variation among recently derived self-compatible populations in their adaptations to autonomous self-fertilization (Rick et al., 1977
, 1979
; Barrett and Shore, 1987
; Husband and Barrett, 1993
; Johnston and Schoen, 1996
).
Pollen limitation of seed production
In comparison to self-incompatible plants, self-compatible plants had consistently higher fruit and seed set in all environments. These results are counter to the hypothesis that reduced visitation by native pollinators may drive the evolution of self-fertilization at the periphery of the Moulton Valley in L. alabamica (Lloyd, 1965
). Although pollen limitation of seed set has been documented in many flowering plant species (Burd, 1994
), few studies have tested the hypothesis that pollinator limitation selectively favors self-compatible or self-fertilizing plants (Inoue et al., 1996
; Fausto et al., 2001
; Goodwillie, 2001
; Herrera et al., 2001
; Elle and Carney, 2003
; Schueller, 2004
). Results from studies have supported the hypothesis that self-fertilization allows plants to produce extra seed when pollinator activity is low (Inoue et al., 1996
; Fausto et al., 2001
; Goodwillie, 2001
; Elle and Carney, 2003
; Davis and Delph, 2005
), though other attempts have not found support for the idea that pollinator limitation drives the evolution of autonomous self-fertilization (Leclerc-Potvin and Ritland, 1994
; Klips and Snow, 1997
; Eckert and Schaefer, 1998
; Herrera et al., 2001
; Schueller, 2004
).
It is possible that natural selection favors self-compatibility in peripheral environments during years of low pollinator activity, which would require multiple seasons of study to detect (Piper et al., 1986
; Burd, 1994
; Goodwillie, 2001
; Herrera et al., 2001
; Kalisz et al., 2004
; Schueller, 2004
). Based on the results of this experiment in a single year, self-incompatible genotypes experienced some pollen limitation of seed set in all environments. These results are perhaps not too surprising because this winter annual flowers during the cold temperatures of March and April, when the foraging activity of their insect pollinators may be limited (Rollins, 1963
). The fact that self-compatibility becomes established in peripheral environments is most likely explained by the fact that reductions in population size or density may further limit seed production in a species with genetically controlled self-incompatibility (Byers and Meagher, 1992
; Reinartz and Les, 1994
; Fischer et al., 2003
). Reductions in plant density may be particularly pronounced at the periphery of the Moulton Valley where the environment is less suitable for the growth of Leavenworthia. In support of this idea, the two highly self-compatible populations belonging to the a4 race became extinct during the period of study (J. Busch, personal observation). Catastrophic declines in population size have also been implicated in the evolution of self-pollination in Clarkia xantiana, an annual plant endemic to the woodlands in the Sierra Nevada foothills (Moore and Lewis, 1965
; Fausto et al., 2001
; Moeller and Geber, 2005
).
Self-compatibility and sequence diversity
If peripheral populations have been small for long periods of time or undergo frequent bottlenecks in size, then these populations should be genetically depauperate. In this study, a self-incompatible population exhibited relatively high nucleotide diversity (1.1% < < 1.8%), whereas two self-compatible populations maintained much less genetic variation (0 < < 0.1%). Since geographically central and peripheral populations of L. alabamica simultaneously differ in size, persistence, and the maintenance of self-incompatibility, it is hard to attribute reductions in sequence diversity within the self-compatible populations to the effects of small size per se or increased rates of self-fertilization (Schoen et al., 1996
; Ingvarsson, 2002
). Nevertheless, the nearly complete loss of genetic variation in self-compatible populations of L. alabamica supports results from other studies that have compared genetic diversity in closely related self-incompatible and self-compatible taxa (Rick et al., 1977
, 1979
; Hamrick and Godt, 1996
; Savolainen et al., 2000
; Charlesworth, 2003
).
Sequence diversities within the one self-incompatible and two self-compatible populations in this experiment are consistent with previous work on the intron 12 region of PgiC in the genus Leavenworthia (Filatov and Charlesworth, 1999
; Liu et al., 1999
). The species L. crassa, which is the sister taxon of L. alabamica, displays similar variation among populations in the presence or absence of sporophytic self-incompatibility (Lloyd, 1965
, 1967
). Nucleotide diversities in self-incompatible populations of L. crassa range from 0.5 to 1%, whereas three highly self-compatible populations were completely monomorphic at intron 12 (Liu et al., 1999
). Analyses of intron variation over a broad 2.3-kb region of the PgiC gene in the self-incompatible species L. stylosa found evidence of long-term balancing selection, and relatively high nucleotide diversity near 5% (Filatov and Charlesworth, 1999
). In contrast, the close self-compatible relatives L. torulosa and L. uniflora lack any within-population variation within intron 12 of PgiC (Liu et al., 1999
). These results suggest that the multiple independent derivations of self-compatibility in the genus Leavenworthia are all associated with nearly complete reductions in sequence diversity within populations (Innan and Tajima, 2002
; Charlesworth, 2003
).
Conclusions
There has long been interest in understanding the ecological factors that favor the evolution of self-compatibility and adaptations to self-fertilization (Darwin, 1876
; Stebbins, 1974
), which is perhaps the most common transition observed in plants (Barrett et al., 1996
; Kohn et al., 1996
; Schoen et al., 1997
; Barrett, 2002
). One recurring theme in the evolution of inbreeding in plants is the association between isolated, marginal, island, or pollinator-poor environments with self-compatible mating systems (Baker, 1955
, 1967
; Lloyd, 1980
; Schueller, 2004
; Herlihy and Eckert, 2005
). The results of this study suggest that consistent pollen limitation of seed set favors self-compatible genotypes in all populations of L. alabamica. Although self-compatibility is selectively favored in all environments, this mode of reproduction appears to invade and spread to high frequency only in peripheral and ecologically marginal environments, which support fewer individuals. These results support the idea that decreased population size or abundance in peripheral, island, or isolated environments may strongly favor the dissolution of genetically controlled self-incompatibility systems in flowering plants (Baker, 1955
, 1967
; Schoen and Brown, 1991
; Pannell and Barrett, 1998
).
FOOTNOTES
1 The author thanks L. Delph for discussion and advice. Comments from D. Bell, Y. Brandvain, M. Brothers, C. Herlihy, D. Schoen, J. Steven, and two anonymous reviewers significantly improved the presentation of ideas in this manuscript. I. Anderson helped locate populations during the spring of 2002 and assisted in the reciprocal-transplant experiment. J. Gillece and E. Osnas helped collect data in the field, and O. Grissom, R. Hardin, and E. Speck allowed experiments to be conducted on their private property. The author thanks L. Washington for conducting sequencing reactions and D. Charlesworth, M. Neiman, C. Saintagne, and I. Scotti for advice and technical help with molecular work. Funding was provided by the Indiana Academy of Sciences, Indiana University, NSF, Sigma Xi, and NSF grant DEB-0075318 to L. Delph. 
2 (e-mail: jbusch{at}bio.indiana.edu
), present address: Department of Biology, McGill University, 1205 Docteur Penfield, Montreal, Quebec, Canada H3A 1B1
LITERATURE CITED
Baker H. G. 1955 Self-compatibility and establishment after "long-distance" dispersal. Evolution 9: 347-348[CrossRef][ISI]
Baker H. G. 1967 Support for Baker's law—as a rule. Evolution 21: 853-856[CrossRef][ISI]
Barrett S. C. H. 2002 The evolution of plant sexual diversity. Nature Genetics 3: 274-284[CrossRef][ISI][Medline]
Barrett S. C. H. L. D. Harder A. C. Worley 1996 The comparative biology of pollination and mating in flowering plants. Philosophical Transactions of the Royal Society of London, B, Biological Sciences 351: 1271-1280[CrossRef]
Barrett S. C. H. M. T. Morgan B. C. Husband 1989 The dissolution of a complex genetic polymorphism: the evolution of self-fertilization in tristylous Eichhornia paniculata (Pontedericaceae). Evolution 43: 1398-1416[CrossRef][ISI]
Barrett S. C. H. J. S. Shore 1987 Variation and evolution of breeding systems in the Turnera ulmifolia L. complex (Turneraceae). Evolution 41: 340-354[CrossRef][ISI]
Baskin J. M. D. H. Webb C. C. Baskin 1995 A floristic plant ecology study of the limestone glades of northern Alabama. Bulletin of the Torrey Botanical Club 122: 226-242[CrossRef][ISI]
Bateman A. J. 1955 Self-incompatibility systems in Angiosperms. III. Cruciferae. Heredity 9: 53-68
Brown J. H. 1984 On the relationship between abundance and distribution of species. American Naturalist 124: 255-279[CrossRef][ISI]
Burd M. 1994 Bateman's principle and plant reproduction: the role of pollen limitation in fruit and seed set. Botanical Review 60: 83-139[CrossRef][ISI]
Busch J. W. 2005 Inbreeding depression in self-incompatible and self-compatible populations of Leavenworthia alabamica. Heredity 94: 159-165[CrossRef][ISI][Medline]
Byers D. L. T. R. Meagher 1992 Mate availiability in small populations of plants with homomorphic self-incompatibility. Heredity 68: 353-359[ISI]
Charlesworth D. 2003 Effects of inbreeding on the genetic diversity of populations. Philosophical Transactions of the Royal Society of London, B, Biological Sciences 358: 1051-1070[CrossRef]
Charlesworth D. B. Charlesworth 1981 Allocation of resources to male and female functions in hermaphrodites. Biological Journal of the Linnaean Society 15: 57-74
Charlesworth D. Z. Yang 1998 Allozyme diversity in Leavenworthia populations with different inbreeding levels. Heredity 81: 453-461
Cruden R. W. 1977 Pollen–ovule ratios: a conservative indicator of breeding system in flowering plants. Evolution 31: 32-46
Darwin C. 1876 The effects of cross- and self-fertilization in the vegetable kingdom. John Murray, London, UK
Davis S. L. L. F. Delph 2005 Prior selfing and gynomonoecy in Silene noctiflora L. (Caryophyllaceae): opportunities for enhanced outcrossing and reproductive assurance. International Journal of Plant Sciences: in press
Eckert C. G. S. C. H. Barrett 1992 Stochastic loss of style morphs from populations of tristylous Lythrum salicaria and Decodon verticillatus (Lythraceae). Evolution 46: 1014-1029[CrossRef][ISI]
Eckert C. G. A. Schaefer 1998 Does self-pollination provide reproductive assurance in Aquilegia canadensis (Ranunculaceae)?. American Journal of Botany 85: 919-924[Abstract]
Elle E. R. Carney 2003 Reproductive assurance varies with flower size in Collinsia parviflora (Scrophulariaceae). American Journal of Botany 90: 888-896
Fausto J. A. Jr. V. M. Eckhart M. A. Geber 2001 Reproductive assurance and the evolutionary ecology of self-pollination in Clarkia xantiana (Onagraceae). American Journal of Botany 88: 1794-1800
Filatov D. A. D. Charlesworth 1999 DNA polymorphism, haplotype structure, and balancing selection in the Leavenworthia PgiC locus. Genetics 153: 1423-1434
Fischer M. M. Hock M. Paschke 2003 Low genetic variation reduces cross-compatibility and offspring fitness in populations of a narrow endemic plant with a self-incompatibility system. Conservation Genetics 4: 325-336[CrossRef][ISI]
Goodwillie C. 2001 Pollen limitation and the evolution of self-compatibility in Linanthus (Polemoniaceae). International Journal of Plant Sciences 162: 1283-1292[CrossRef][ISI]
Hamrick J. L. M. J. W. Godt 1996 Effects of life history traits on genetic diversity in plant populations. Philosophical Transactions of the Royal Society of London, B, Biological Sciences 351: 1291-1298[CrossRef]
Herlihy C. R. C. G. Eckert 2002 Genetic cost of reproductive assurance in a self-fertilizing plant. Nature 416: 320-323[CrossRef][Medline]
Herlihy C. R. C. G. Eckert 2005 Evolution of self-fertilization at geographical range margins? A comparison of demographic, floral, and mating system variables in central vs. peripheral populations of Aquilegia canadensis (Ranunculaceae). American Journal of Botany 92: 744-751
Herrera C. M. A. M. Sanchez-Lafuente M. Medrano J. Guitian X. Cedra P. Rey 2001 Geographical variation in autonomous self-pollination levels unrelated to pollinator service in Helleborus foetidus (Ranunculaceae). American Journal of Botany 88: 1025-1032
Husband B. C. S. C. H. Barrett 1993 Multiple origins of self-fertilization in tristylous Eichornia paniculata (Pontederiaceae): inferences from style morph and isozyme variation. Journal of Evolutionary Biology 6: 591-608[CrossRef][ISI]
Ingvarsson P. K. 2002 A metapopulation perspective on genetic diversity and differentiation in partially self-fertilizing plants. Evolution 56: 2368-2373[CrossRef][ISI][Medline]
Innan H. F. Tajima 2002 A statistical test for the difference in the amounts of DNA variation between two populations. Genetical Research 80: 15-25[CrossRef][ISI][Medline]
Inoue K. M. Maki M. Masuda 1996 Evolution of Campanula flowers in relation to insect pollinators on islands. In D. G. Lloyd and S. C. H. Barrett [eds.], Floral biology: studies on floral evolution in animal-pollinated plants, 377–401. Chapman and Hall, New York, New York, USA
Jain S. K. 1976 The evolution of inbreeding in plants. Annual Review of Ecology and Systematics 7: 469-495
Johnston D. W. Jr. 1930 Physical divisions of northern Alabama. Geological Survey of Alabama Bulletin 38: 1-48
Johnston M. O. D. J. Schoen 1996 Correlated evolution of self-fertilization and inbreeding depression: an experimental study of nine populations of Amsinckia (Boraginaceae). Evolution 50: 1478-1491[CrossRef][ISI]
Kalisz S. D. W. Vogler K. M. Hanley 2004 Context-dependent autonomous self-fertilization yields reproductive assurance and mixed mating. Nature 430: 884-886[CrossRef][Medline]
Kearns C. A. D. W. Inouye 1993 Techniques for pollination biologists. University Press of Colorado, Niwot, Colorado, USA
Klips R. A. A. A. Snow 1997 Delayed autonomous self-pollination in Hibiscus laevis (Malvaceae). American Journal of Botany 84: 48-53[Abstract]
Kohn J. R. S. W. Graham B. Morton J. J. Doyle S. C. H. Barrett 1996 Reconstruction of the evolution of reproductive characters in Pontederiaceae using phylogenetic evidence from chloroplast DNA restriction-site variation. Evolution 50: 1454-1469[CrossRef][ISI]
Krebs C. J. 1999 Ecological methodology, 2nd ed. Addison Wesley Longman, Menlo Park, California, USA
Leclerc-Potvin C. K. Ritland 1994 Modes of self-fertilization in Mimulus guttatus (Scrophulariaceae): a field experiment. American Journal of Botany 81: 199-205[CrossRef][ISI]
Levin D. A. 1996 The evolutionary significance of pseudo-self-fertility. American Naturalist 148: 321-332[CrossRef][ISI]
Liu F. D. Charlesworth M. Kreitman 1999 The effect of mating system differences on nucleotide diversity at the phosphoglucose isomerase locus in the plant genus Leavenworthia. Genetics 151: 343-357
Lloyd D. G. 1965 Evolution of self-compatibility and racial differentiation in Leavenworthia (Cruciferae). Contributions from the Gray Herbarium of Harvard University 195: 3-134
Lloyd D. G. 1967 The genetics of self-incompatibility in Leavenworthia crassa Rollins (Cruciferae). Genetica 38: 227-242[CrossRef][ISI]
Lloyd D. G. 1979 Some reproductive factors affecting the selection of self-fertilization in plants. American Naturalist 113: 67-79[CrossRef][ISI]
Lloyd D. G. 1980 Demographic factors and mating patterns in angiosperms. In O. T. Solbrig [ed.], Demography and evolution in plant populations, 67–88. University of California Press, Berkeley, California, USA
Lloyd D. G. 1992 Self- and cross-fertilization in plants. II. The selection of self-fertilization. International Journal of Plant Sciences 153: 370-380[CrossRef]
Lyons E. E. J. Antonovics 1991 Breeding system evolution in Leavenworthia—breeding system variation and reproductive success in natural populations of Leavenworthia crassa (Cruciferae). American Journal of Botany 78: 270-287[CrossRef][ISI]
Moeller D. A. M. A. Geber 2005 Ecological context of the evolution of self-pollination in Clarkia xantiana: population size, plant communities, and reproductive assurance. Evolution 59: 786-799[ISI][Medline]
Moore D. M. H. Lewis 1965 The evolution of self-pollination in Clarkia xantiana. Evolution 19: 104-114[CrossRef][ISI]
Niu T. Z. S. Qin X. Xu J. Liu 2002 Bayesian haplotype inference for multiple linked single-nucleotide polymorphisms. American Journal of Human Genetics 70: 157-169[CrossRef][ISI][Medline]
Pannell J. R. S. C. H. Barrett 1998 Baker's law revisited: reproductive assurance in a metapopulation. Evolution 52: 657-668[CrossRef][ISI]
Piper J. G. B. Charlesworth D. Charlesworth 1986 Breeding system evolution in Primula vulgaris and the role of reproductive assurance. Heredity 56: 207-217[ISI]
Reinartz J. A. D. H. Les 1994 Bottleneck-induced dissolution of self-incompatibility and breeding system consequences in Aster furcatus (Asteraceae). American Journal of Botany 81: 446-455[CrossRef][ISI]
Rick C. M. J. F. Fobes M. Holle 1977 Genetic variation in Lycopersicon pimpinellifolium: evidence of evolutionary change in mating systems. Plant Systematics and Evolution 127: 139-170[CrossRef][ISI]
Rick C. M. J. F. Fobes S. D. Tanksley 1979 Evolution of mating systems in Lycopersicon hirsutum as deduced from genetic variation in electrophoretic and morphological characters. Plant Systematics and Evolution 132: 279-298[CrossRef][ISI]
Rollins R. C. 1963 The evolution and systematics of Leavenworthia (Cruciferae). Contributions from the Gray Herbarium of Harvard University 192: 3-98
Rozas J. J. C. Sanchez-Delbarrio X. Messeguer R. Rozas 2003 DNAsp, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19: 2496-2497
Sagarin R. D. S. D. Gaines 2002 The ‘abundant centre’ distribution: to what extent is it a biogeographical rule?. Ecology Letters 5: 137-147
Savolainen O. C. H. Langley B. P. Lazzaro H. Freville 2000 Contrasting patterns of nucleotide polymorphism at the alcohol dehydrogenase locus in the outcrossing Arabidopsis lyrata and the selfing Arabidopsis thaliana. Molecular Biology and Evolution 17: 645-655
Schoen D. J. A. H. D. Brown 1991 Interspecific variation in population gene diversity and effective population size correlates with the mating system in plants. Proceedings of the National Academy of Sciences, USA 88: 4494-4497
Schoen D. J. M. O. Johnston A. L'Hereux J. V. Marsolais 1997 Evolutionary history of the mating system in Amsinckia (Boraginaceae). Evolution 51: 1090-1099[CrossRef][ISI]
Schoen D. J. M. T. Morgan T. Bataillon 1996 How does self-pollination evolve? Inferences from floral ecology and molecular genetic variation. Philosophical Transactions of the Royal Society of London, B, Biological Sciences 351: 1281-1290[CrossRef]
Schueller S. K. 2004 Self-pollination in island and mainland populations of the introduced hummingbird-pollinated plant, Nicotiana glauca (Solanaceae). American Journal of Botany 91: 672-681
Shimizu K. K. J. M. Cork A. L. Caicedo C. A. Mays R. C. Moore K. M. Olsen S. Ruzsa G. Coop C. D. Bustamante P. Awadalla M. D. Purugganan 2004 Darwinian selection on a selfing locus. Science 306: 2081-2084
Sokal R. F. J. Rohlf 1995 Biometry, 3rd ed. Freeman, New York, New York, USA
Solbrig O. T. R. C. Rollins 1977 Evolution of autogamy in species of the mustard genus Leavenworthia. Evolution 31: 265-281[CrossRef][ISI]
Stebbins G. L. 1957 Self-fertilization and population variability in the higher plants. American Naturalist 91: 337-354[CrossRef][ISI]
Stebbins G. L. 1974 Flowering plants: evolution above the species level. Belknap Press of Harvard University, Cambridge, Massachusetts, USA
Tajima F. 1989a Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123: 585-595
Tajima F. 1989b The effect of a change in population size on DNA polymorphism. Genetics 123: 597-601
Takebayashi N. P. L. Morrell 2001 Is self-fertilization an evolutionary dead end? Revisiting an old hypothesis with genetic theories and a macroevolutionary approach. American Journal of Botany 88: 1143-1150
Wright S. 1964 The distribution of self-incompatibility alleles in populations. Evolution 18: 609-619[CrossRef][ISI]
This article has been cited by other articles:
|
|
 |
|
  S. Kubota, Y. Kameyama, A. S. Hirao, and M. Ohara Adaptive significance of self-fertilization in a hermaphroditic perennial, Trillium camschatcense (Melanthiaceae) Am. J. Botany, April 1, 2008; 95(4): 482 - 489. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. W. Busch, J. Sharma, and D. J. Schoen Molecular Characterization of Lal2, an SRK-Like Gene Linked to the S-Locus in the Wild Mustard Leavenworthia alabamica Genetics, April 1, 2008; 178(4): 2055 - 2067. [Abstract] [Full Text] [PDF]
|
|
denotes a significant difference between genotypes at the 
