| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Systematics |
2Department of Botany, California Academy of Sciences, Golden Gate Park, San Francisco, California 94118 USA; 3Department of Biology, University of Missouri–St. Louis, St. Louis, Missouri 63121 USA; 4Systematische Botanik, Ludwig Maximilians University Munich, Menzinger Str. 67, D-80638 Munich, Germany; 5Departamento de Botânica, IB, Universidade Estadual de Campinas, Caixa Postal 6109, 13083-970 Campinas, São Paulo, Brazil
Received for publication August 21, 2003. Accepted for publication February 12, 2004.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Key Words: cerrado • ITS • Melastomataceae • Microlicieae • ndhF • phylogeny • rbcL • rpl16
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). Traditional classifications of the Melastomataceae have attributed between 15 and 17 genera to the Microlicieae (Table 1) based on reniform, oblong seeds with a foveolate testa in combination with capsular fruits, basally prolonged anther connectives, rostrate anther thecae, and glabrous ovaries (Triana, 1871
; Cogniaux, 1891
). The imprecise circumscription of several genera in the tribe has long been recognized (Hooker, 1867
; Triana, 1871
; Baillon, 1877
; Cogniaux, 1891
), but its monophyletic status had not been questioned until the publication of a morphologically based classification of the Melastomataceae in which Centradenia, Poteranthera, and Siphanthera were excluded from the tribe and several other genera were placed into synonymy, thereby reducing it to 11 genera (Renner, 1993
; Table 1). More recently, from observations of seed morphology in connection with taxonomic work on Lavoisiera, the core Microlicieae have been suggested to comprise just six genera (Almeda and Martins, 2001
; Table 1).
|
The age, origin, and dynamics of Neotropical savannas and their environmental determinants continue to be debated (Sarmiento, 1984
). Most of the old Precambrian shield of interior Brazil now covered by cerrado has been available for occupation by land plants since before Africa and South America separated from one another between 95 and 100 million years ago (mya; Pitman et al., 1993
), but this tells us nothing about the initial availability of eroded substrates that now harbor a rich assemblage of Microlicieae. The prototype of present-day cerrado in Brazil possibly existed back in the Cretaceous, but the most dynamic stage of development of this biome is thought to have occurred during the climatic fluctuations that began at the onset of the Quaternary (Oliveira-Filho and Ratter, 2002). Paleoenvironmental studies have confirmed that forests and cerrado vegetation underwent cycles of expansion and contraction in Brazil during the Quaternary with the greatest expansion of cerrado occurring within the last 10 000 years, and vegetation resembling present-day cerrado is not known prior to 7000 years before present in central Brazil (Ledru, 2002
). As far as we can ascertain, there are no records documenting a paleofloristic assemblage that resembles the current vegetation of campo rupestre.
Additional insight into the origin and development of the vegetation of cerrado and campo rupestre can be gained through phylogenetic study of the plant groups endemic to these habitats, but few such groups have been studied in this context. Here we use DNA sequences from the nuclear ribosomal internal transcribed spacer (ITS) region, the chloroplast genes rbcL and ndhF, the chloroplast rpl16 intron, and a data set based on gross morphology to evaluate the monophyly, generic composition, and generic relationships of the Microlicieae. We then use the molecular data to estimate the time of initial divergence of the Microlicieae with which to make inferences on the paleoecology of cerrado vegetation.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
) and BIOLASE (Bioline USA, Randolph, Massachusetts, USA) as the DNA polymerase. The PCR products were purified with the Wizard PCR Preps DNA Purification System (Promega, Madison, Wisconsin, USA), cycle sequencing was performed with the ABI Prism BigDye Terminators v2.0 Cycle Sequencing Reaction Kit (Applied Biosystems, Foster City, California, USA) by using 1/4-scale reaction mixtures in a model 9600 PCR System thermal cycler (Perkin-Elmer, Boston, Massachusetts, USA), and sequences were determined with an ABI Prism 3100 Genetic Analyzer (Applied Biosystems). Forward and reverse reads were obtained for all samples. Sequences were edited with the computer program Sequencher (3.0 and 4.1; Gene Codes, Ann Arbor, Michigan, USA) and all sequences have been deposited in GenBank (Appendix; see Supplemental Data accompanying the online version of this article).
To evaluate the monophyly of the Microlicieae, we incorporated nine of the 11 genera of this tribe sensu Renner (1993
; Table 1) into a previously generated data set of rpl16 sequences representing all tribes and major clades of Melastomataceae (Clausing and Renner, 2001
). The Microlicieae samples included seven newly generated rpl16 sequences and the three sequences from Clausing and Renner (2001
; Rhynchanthera was represented by two samples). A newly generated sequence from Siphanthera was also included on the basis of Cogniaux (1891)
, who placed this genus in the Microlicieae (Table 1). Two species of Memecylaceae (Memecylon edule and Mouriri helleri) served to root the tree on the basis of Clausing and Renner (2001)
. We employed "rpl-mel-exon1" (5'–GCTATGCTTAGCGTGTGACTCGT–3') and "L16 exon2" (Downie et al., 2000
) as amplification primers. We sequenced rpl16 with the amplification primers plus the internal primers "rpl-mel-748F" (5'–TAACAAAAATACATTCTTCAT–3') and "rpl-mel-666R" (5'–CTTCACGGGCGAATATTGAC–3').
To attempt to improve phylogenetic resolution and statistical support for the placement of "non-core" genera of Microlicieae beyond that recovered from analysis of rpl16 sequences (see Results), we generated DNA sequences of the chloroplast genes rbcL and ndhF for Cambessedesia, Castratella, and Eriocnema and an rbcL sequence from Siphanthera (Appendix; see Supplemental Data accompanying the online version of this article; Siphanthera was not sampled for ndhF because it failed to amplify despite repeated attempts). We then included these sequences in previously generated data sets of each gene comprising many of the same samples from the rpl16 analysis, including three genera of "core" Microlicieae. The first half of the rbcL gene was amplified and sequenced with primers 1F and 724R; the second half was amplified and sequenced with 724F (i.e., the reverse-complement of 724R) and 1460R (5'–CTTTTAGTAAAAGATTGGGCCGAG–3'; Olmstead et al., 1992
; Fay et al., 1997
). The ndhF gene was amplified by following the protocol of Clausing and Renner (2001)
with primers developed by Olmstead and Sweere (1994)
, except that for some samples the gene was amplified in sections with various combinations of internal and external primers. Outgroups were the same as those employed for rpl16.
To assess phylogenetic relationships within core Microlicieae (see Results), we expanded the sample of core-genera rpl16 sequences to 26. This encompassed eight species of Lavoisiera, nine of Microlicia, four of Trembleya, and one each of Chaetostoma, Rhynchanthera, and Stenodon (Appendix; R. grandiflora and T. parviflora were each represented by two samples). All of these, except three from Clausing and Renner (2001)
, were newly generated for this study. Rhynchanthera served as outgroup on the basis of the family-wide analyses (see Results). We combined the rpl16 data with 24 newly generated core Microlicieae DNA sequences of the intercistronic transcribed spacer (ITS) region of nuclear ribosomal DNA representing 24 species (Appendix). The ITS amplification and sequencing employed primers from Swensen et al. (1998)
and proceeded as described earlier. Because taxonomic knowledge of Microlicia is poor, five of the Microlicia samples included in the analysis are designated only as "sp." and two are designated with "aff." (affinity). At least some of these likely represent undescribed species.
Molecular data analysis
The rpl16, ndhF, and ITS sequences were aligned manually; the rbcL sequences required no alignment. Gaps introduced into the alignment were treated as missing data. All final data matrices are available through TreeBASE (http://www.herbaria.harvard.edu/treebase).
Phylogenetic analyses of the various data sets employed maximum parsimony with the computer program PAUP* 4.0b10 (Swofford, 1998
). The search strategy for finding the most parsimonious trees followed that of Fritsch et al. (2001)
, except that steepest descent was deselected. Relative support for individual clades was estimated with the parsimony bootstrap method (Felsenstein, 1985
) as implemented in PAUP* under the conditions described in Fritsch et al. (2001)
.
Morphological analysis
A data set of 10 parsimony-informative morphological characters assessed for 10 of the 11 genera of Microlicieae sensu Renner (1993)
plus Siphanthera was constructed to provide a phylogenetic comparison with the molecular-based results (Tables 2 and 3). Bucquetia has been placed confidently within the tribe Merianieae by Solt and Wurdack (1980
; based on chromosome number) and Whiffin and Tomb (1972
; based on seed morphology). Thus, Bucquetia was not included in the analysis. The genus Tibouchina (tribe Melastomeae) was employed as outgroup on the basis of prior results in which the sister group of Microlicieae is a clade comprising members of the tribes Rhexieae and Melastomeae (Clausing and Renner, 2001
). Phylogenetic analysis was conducted with parsimony as described earlier, except that in cases where characters had multiple character states the taxa were treated as polymorphic rather than uncertain. Characters were unordered and equally weighted, and multistate characters were coded as nonadditive.
|
|
) as implemented in the shareware computer program r8s. Penalized likelihood permits deviations from a molecular clock and uses cross-validation to determine the best level of clock enforcement ("smoothing") with the given data. The input branch lengths (calculated from genetic distances) for r8s were determined under the General-Time-Reversible model of sequence evolution with the rate matrix, gamma parameter, and proportion of invariable sites all estimated on the single most parsimonious tree obtained from combined rbcL, ndhF, and rpl16 data after exclusion of all gapped or ambiguous nucleotide sites. The two most distant outgroups were pruned from the r8s divergence time analysis (see Sanderson, 2002
).
The genetic distances were calibrated in three alternative ways. (1) The root of crown Melastomataceae was constrained to be minimally 53 million years (my) old and maximally 90 my old. The minimum age is based on the oldest known fossil of the family, a leaf from the Golden Valley formation (Hickey, 1977
; a similar leaf fossil is depicted in Renner et al., 2001
). The maximum age is based on the oldest fossils of the order Myrtales, 88-my-old pollen of Myrtaceae (Morley, 2000
), to which Melastomataceae belong. Allowing maximum ages of 100 or 130 my did not significantly influence the results. (2) The age of crown Melastomeae was constrained to 24 my on the basis of the oldest (highly distinct and well documented) seeds of that clade, which are between 23 and 26 my old (Renner et al., 2001
). (3) A third calibration was based on an Upper Oligocene Meriania-like leaf from northwestern Colombia (Huertas, 1977
; the strata from which this leaf comes have been dated to the Upper Oligocene, not Eocene as suggested in the original publication; L. N. Parra, University of Medellín, personal communication, 2001). This leaf constrains crown Merianieae to 30 my old.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
|
50%).
|
|
|
50%) with the exception of M. sp. 3, which is placed as sister to all other taxa except Rhynchanthera (50). The only other well-supported areas of the tree are the placement of L. crassifolia as sister to the rest of Lavoisiera (93%) and the sister-group relationship between M. aff. tomentella and M. sp. 5.
|
|
and Renner et al. (2001)
, a maximum likelihood ratio test with the combined rpl16 + rbcL + ndhF data for 36 taxa (after exclusion of all gapped or ambiguous sites) rejected a molecular clock, albeit barely (as long as distant outgroups were excluded). Nonparametric rate smoothing with the cross-validated optimal level of smoothing estimated to be approximately 300 yielded age estimates of 18 my for core Microlicieae crown group diversification (Lavoisiera, Microlicia, and Rhynchanthera) and 3.7 my for Lavoisiera + Microlicia crown group diversification. |
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
. These genera all possess reniform ellipsoid or elongate seeds with a foveolate or lacunate-reticulate testa, and our data strongly suggest that these characters are synapomorphies that unite this group (Fig. 7). Cambessedesia, Castratella, Eriocnema, and Siphanthera can now confidently be excluded from the Microlicieae on the basis of our morphological and molecular results, and seed morphology in these four genera can be accommodated in other tribes.
|
; Fig. 7G). Our samples of this genus grouped strongly within the clade comprising core Microlicieae and the tribes Melastomeae, Sonerileae, Dissochaeteae, Bertolonieae (in part), and Blakeeae. Further resolution of its placement will require a broader generic sampling of Neotropical Melastomataceae and more phylogenetically informative data, although our data indicate that it can be confidently excluded from within Melastomeae and the clade consisting of Sonerileae and Dissochaeteae.
The well-supported grouping of Eriocnema with representatives of the Miconieae is surprising and unexpected because of its fleshy subcaulescent rhizomatous habit (vs. woody habit in Miconieae), capsular fruit (vs. usually a berry), and cuneate-clavate seeds with an inconspicuously colliculate testa (vs. ovoid, pyramidate to lunate seeds with a testa that varies from smooth to muriculate or complexly costate-tuberculate; Fig. 7H). Eriocnema is similar to many Miconieae, however, in its unappendaged anther connectives and a chromosome number of n = 17 (E. R. Forni-Martins, Universidade Estadual de Campinas, personal communication; Almeda, 1997a
), and our data suggest that these two characters are synapomorphies for Miconieae + Eriocnema. One or more of the members of tribe Bertolonieae may eventually be found to group with Eriocnema. The herbaceous habit, cuneate-clavate seeds with a colliculate testa, and chromosome number are possible derived characters shared between Eriocnema and some members of Bertolonieae, a Neotropical tribe that remains poorly sampled for molecular data, and it may be significant that one species of Bertolonia was originally described in Eriocnema (Baumgratz, 1989/1990
: p. 116). Bertolonieae is polyphyletic, with Macrocentrum grouping well away from the rest of the members of the tribe sampled for molecular data (Fig. 2; Clausing and Renner, 2001
). The strongly supported placement of Eriocnema in the clade that includes Macrocentrum in the three-gene analysis (Fig. 2) may be significant in this regard.
Molecular data are particularly useful in assessing the placement of Castratella, a genus comprising two species of rosulate herbaceous perennials confined to the Andean páramos of Colombia and Venezuela. Castratella groups strongly with Monochaetum, another montane genus with a center of diversity in the Andes, and the clade comprising these two genera is strongly supported within Melastomeae. Characters possibly synapomorphic for Castratella and Monochaetum are four-merous flowers, a four-locular ovary, and interdigitating cells of the seed testa. Unlike most members of Melastomeae, Castratella lacks both staminal pedoconnectives and appendages, features likely to be derived within the tribe. In contrast to other Melastomeae, however, it has the apparent autapomorphies of linear-oblong seeds and a colliculate testa (vs. cochleate seeds and a tuberculate, costate, or foveolate testa in Melastomeae; Fig. 7F).
Our data agree with Renner's (1993)
reassignment of Siphanthera to the Melastomeae. Like Aciotis and other members of Melastomeae (Solt and Wurdack, 1980
; Almeda, 1997b
), Siphanthera has ventral staminal appendages and a base chromosome number of x = 10 (F. Almeda and O. Robinson, unpublished data), but it has unusual lacrimiform seeds with an areolate testa (Fig. 7E). This seed type is clearly an autapomorphy within Melastomataceae, being unknown in the rest of the family.
Among other genera traditionally placed in the Microlicieae, only Lithobium and Bucquetia remain to be studied in a molecular phylogenetic context. Lithobium of central Brazil is a monotypic subcaulescent herb of wet sites with trimerous flowers, unappendaged anther connectives, and clavate-obovoid colliculate seeds. Bucquetia, an Andean genus of three species, has four-merous flowers, unappendaged or dorsally appendiculate anthers, and oblong-cuneate smooth seeds (Fig. 7I). From morphology, we predict that molecular and cytological evidence will support their removal from the Microlicieae.
Core Microlicieae
Our data provide strong evidence for the placement of Rhynchanthera as sister to the remaining core group. The consistent presence of filamentous staminodia distinguishes Rhynchanthera from all other members of core Microlicieae (Renner, 1990
). Filamentous staminodia are otherwise uncommon among Neotropical Melastomataceae and largely confined to dioecious species of Miconia section Cremanium (Siphanthera is polymorphic for staminode presence and this parsimony-uninformative character was not included in our analysis). Moreover, Rhynchanthera has a base chromosome number of x = 10 (Solt and Wurdack, 1980
; F. Almeda et al., unpublished data), whereas other genera of core Microlicieae (except Stenodon, which remains to be studied cytologically) have a base chromosome number of x = 12 (F. Almeda et al., unpublished data). A putative base number for the family is x = 12 (Almeda, 1997c
), suggesting that all core Microlicieae except Rhynchanthera have retained the primitive chromosome number for the family. We have been unable to detect consistent non-molecular characters that would be synapomorphic for the non-Rhynchanthera core Microlicieae clade.
Other strongly supported major clades are those corresponding to Lavoisiera and Trembleya. Lavoisiera has been recently redefined to include species with a partially inferior ovary, laterally flattened placental intrusions, capsular fruits that dehisce from the base to the apex, and a persistent columella (Almeda and Martins, 2001
). The latter two characters are unique in the family. We can detect no morphological characters that support the placement of L. crassifolia as the strongly supported first-diverging lineage within Lavoisiera. Trembleya, a genus of 19 species, is defined by a three- to five-locular ovary, deciduous columella, subpeltate placental intrusions, and pedicellate or subsessile mostly five-merous flowers borne in compound bracteolate dichasia or reduced modifications thereof. Although the samples of Trembleya form a monophyletic group in our analysis with relatively strong support, data from more samples are desirable to confirm the monophyly of this group.
The positions of the remaining genera of core Microlicieae are only weakly supported. Microlicia is the largest genus of core Microlicieae, with possibly over 175 species, and is poorly understood taxonomically. It has five-merous (rarely six- or eight-merous) flowers, a three-locular (rarely four- or five-locular) ovary, magenta, pink, white, or yellow petals, dimorphic stamens within a flower, and well-developed ventral staminal appendages. Chaetostoma, a genus of 12 species, is one of the most distinctive members of core Microlicieae. It is recognized by a ring of appressed adnate hairs that crown the outer hypanthial apex (a character unique in the family), uniformly ericoid leaves, and mature capsules that conspicuously exceed the hypanthium in length. More samples and more phylogenetically informative data will be required to adequately assess the monophyly and phylogenetic relationships of both Microlicia and Chaetostoma. Stenodon, with two species, is found only in cerrado sensu stricto. It superficially resembles Microlicia but has six- to seven-merous flowers, a four- to five-locular ovary, red-magenta petals, stamens that are only slightly unequal within a flower, and inconspicuous ventral staminal appendages. Stenodon is also unlike Microlicia in having thick, woody branches that decorticate like other cerrado shrubs.
The origin and historical biogeography of core Microlicieae
It is clear that core Microlicieae have originated in South America, for two reasons. First, the vast majority of core Microlicieae are endemic to South America; the only species of core Microlicieae known outside of South America are three species of Rhynchanthera found in Mexico and Central America (Renner, 1990
). Second, of these three species, the diploid R. grandiflora (n = 10; F. Almeda et al., unpublished data) is also widely distributed in South America, and R. paludicola (Donn. Sm.) Gleason, endemic to southern Central America, has a chromosome number of n = 20 (Davidse, 1970
; F. Almeda et al., unpublished data). This number is clearly derived from n = 10 and implicates R. paludicola as a tetraploid derivative species. These data suggest migration of Rhynchanthera into Mesoamerica from South America, most likely via the Panama land bridge that formed about 3 mya (Nisancioglu et al., 2003
).
The phylogenetic position of core Microlicieae provides insight into the evolution of drought-tolerance in the Melastomataceae. Species of the family usually thrive under conditions of high humidity and precipitation. The major exception to this in the Neotropics is found in the Microlicieae, nearly endemic to the Brazilian cerrado. The well-nested placement of core Microlicieae within the family (see also Clausing and Renner, 2001
) supports a shift from a generally hydric habitat to the seasonally dry cerrado along the stem leading to core Microlicieae, followed by high diversification in the cerrado.
This scenario is corroborated by the phylogenetic position of Rhynchanthera as sister to the remaining members of core Microlicieae. In contrast to the cerrado endemism displayed by most species in other genera of core Microlicieae, Rhynchanthera is distributed from Mexico to Paraguay where it occurs in open habitats under locally wet conditions. Cerrado species of Rhynchanthera, for example, prefer seasonal, valley-side marshes (veredas) where the water table extends nearly to the surface during the rainy season (Renner, 1990
; Oliveira-Filho and Ratter, 2002); most species in other genera of Microlicieae avoid such wet areas or occur only peripherally near them. Nonetheless, the habitat of Rhynchanthera experiences successive periods of soil waterlogging and pronounced water deficit. In the savannas of Venezuela and central Amazonia, for example, R. grandiflora and R. dichotoma (Desr.) DC. colonize grassy areas that are burned during the dry season (Renner, 1990
). Thus, the habitat of Rhynchanthera can be considered transitional between the hydric habitats typical of most Neotropical Melastomataceae and the seasonally dry cerrado habitats to which most species of the core Microlicieae are restricted. The phylogenetic position of Rhynchanthera as the first-diverging lineage within core Microlicieae is precisely what one would predict on the basis of both its widespread distribution and this aspect of its habitat.
The widespread geographic distribution of Rhynchanthera, as well as its preference for wet habitats, suggests that the most specialized adaptations to cerrado within core Microlicieae occurred after the divergence of Rhynchanthera from the rest of the tribe. In the context of the minimum estimated age of the core Melastomataceae (53 my; Renner et al., 2001
), our relatively recent age estimate of 3.7 my for the crown node of the branch leading to the non-Rhynchanthera core Microlicieae clade is comparable to the time of the most active stage of development for cerrado vegetation beginning near the Tertiary/Quaternary boundary 1.8 mya (Oliveira-Filho and Ratter, 2002), implying an adaptive shift from hydric to seasonally dry habitats in the stem lineage of this group. A Bayesian analysis of rbcL, ndhF, and rpl16 sequences from 52 Melastomataceae and outgroups that used multiple fossil and geological calibrations (S. S. Renner, unpublished manuscript) independently arrived at an age estimate of 16–19 my for core Microlicieae crown group diversification, corroborating our results.
Cerrado vegetation has successively expanded and contracted in response to the climatic fluctuations of the Quaternary (Ledru, 2002
). This periodicity combined with the shallow, low-fertility soils, seasonal drought, and periodic fires that characterize the cerrado undoubtedly were potent forces impelling diversification of the Microlicieae. The time of origin of the cerrado and the adaptations of plants to this unique biome can be further assessed by comparing the phylogenetic data and derived estimates of divergence times presented here with those of other cerrado endemics.
|
FOOTNOTES |
|---|
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Almeda F. 1997b Cytological and nomenclatural notes on the Mesoamerican species of Aciotis (Melastomataceae). Novon 7: 333-337
Almeda F. 1997c Chromosomal observations on the Alzateaceae (Myrtales). Annals of the Missouri Botanical Garden 84: 305-308
Almeda F. A. B. Martins 2001 New combinations and new names in some Brazilian Microlicieae (Melastomataceae), with notes on the delimitation of Lavoisiera, Microlicia, and Trembleya. Novon 11: 1-7
Baillon H. E. 1877 Mélastomacées. Histoire des Plantes, vol. 7, 1–65. L. Hachette et Cie, Paris, France
Baumgratz J. F. A. 1989/1990 O gênero Bertolonia Raddi (Melastomataceae): revisão taxonômica e considerações anatômicas. Arquivos do Jardim Botânico do Rio de Janeiro 30: 69-213[Medline]
Clausing G. S. S. Renner 2001 Molecular phylogenetics of Melastomataceae and Memecylaceae: implications for character evolution. American Journal of Botany 88: 486-498
Cogniaux C. A. 1891 Mélastomacées. In A. de Candolle and C. de Candolle [eds.], Monographiae phanerogamarum, vol. 7, 1–1256. G. Masson, Paris France
Davidse G. 1970 IOPB chromosome number reports XXV. Taxon 19: 103
Dieffenbach C. W. G. S. Dveksler [eds.] 1995 PCR primer: a laboratory manual. Cold Spring Harbor Laboratory, Plainview, New York, USA
Downie S. R. D. S. Katz-Downie M. F. Watson 2000 A phylogeny of the flowering plant family Apiaceae based on chloroplast DNA rpl16 and rpoC1 intron sequences: towards a suprageneric classification of subfamily Apioideae. American Journal of Botany 87: 273-292
Fay M. F. S. M. Swensen M. W. Chase 1997 Taxonomic affinities of Medusagyne oppositifolia (Medusagynaceae). Kew Bulletin 52: 111-120[CrossRef]
Felsenstein J. 1985 Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791[CrossRef][ISI]
Fritsch P. W. C. M. Morton T. Chen C. Meldrum 2001 Phylogeny and biogeography of the Styracaceae. International Journal of Plant Sciences 162: (6 Suppl.) S95-S116[CrossRef]
Hickey L. J. 1977 Stratigraphy and paleobotany of the Golden Valley formation (Early Tertiary) of western North Dakota. Geological Society of America, Memoir 150. Geological Society of America, Boulder, Colorado, USA
Hooker J. D. 1867 Melastomaceae. In G. Bentham and J. D. Hooker [eds.], Genera Plantarum, vol. 1, 725–773. L. Reeve, London, UK
Huertas G. 1977 Una Melastomatácea fósil del Terciario carboneifero de Antioquia (Eoceno). Caldasia 12: 35-39
Ledru M.-P. 2002 Late Quaternary history and evolution of the cerrados as revealed by palynological records. In P. S. Oliviera and R. J. Marquis [eds.], The cerrados of Brazil, 33–50. Columbia University Press, New York, New York, USA
Martins A. B. 1984 Revisão taxonômica do gênero Cambessedesia DC. (Melastomataceae). M.Sc. thesis, Universidade Estadual de Campinas, Campinas, Brazil
Morley R. J. 2000 Origin and evolution of tropical rain forests. John Wiley & Sons, West Sussex, UK
Nisancioglu K. H. M. E. Raymo P. H. Stone 2003 Reorganization of Miocene deep water circulation in response to the shoaling of the Central American Seaway. Paleoceanography 18: 1006[CrossRef]
Oliviera-Filho A. T. J. A. Ratter 2002 Vegetation physiognomies and woody flora of the cerrado biome. In P. S. Oliviera and R. J. Marquis [eds.], The cerrados of Brazil, 91–120. Columbia University Press, New York, New York, USA
Olmstead R. G. H. J. Michaels K. M. Scott J. D. Palmer 1992 Monophyly of the Asteridae and identification of their major lineages inferred from DNA sequences of rbcL. Annals of the Missouri Botanical Garden 79: 249-265
Olmstead R. G. J. A. Sweere 1994 Combining data in phylogenetic systematics: an empirical approach using three molecular data sets in the Solanaceae. Systematic Biology 43: 467-481[CrossRef][ISI]
Pitman W. C., III S. Cande J. LaBrecque J. Pindell 1993 Fragmentation of Gondwana: the separation of Africa from South America. In P. Goldblatt [ed.], Biological relationships between Africa and South America, 15–34. Yale University Press, New Haven, Connecticut, USA
Renner S. S. 1990 A revision of Rhynchanthera (Melastomataceae). Nordic Journal of Botany 9: 601-630[ISI]
Renner S. S. 1993 Phylogeny and classification of the Melastomataceae and Memecylaceae. Nordic Journal of Botany 13: 519-540[ISI]
Renner S. S. In press Bayesian analysis of combined data partitions, using multiple calibrations, supports recent arrival of Melastomataceae in Africa and Madagascar. American Journal of Botany.
Renner S. S. G. Clausing K. Meyer 2001 Historical biogeography of Melastomataceae: the roles of Tertiary migration and long-distance dispersal. American Journal of Botany 88: 1290-1300
Renner S. S. K. Meyer 2001 Melastomataceae come full circle: biogeographic reconstruction and molecular clock dating. Evolution 55: 1315-1324[ISI][Medline]
Sanderson M. J. 2002 Estimating absolute rates of molecular evolution and divergence times: a penalized likelihood approach. Molecular Biology and Evolution 19: 101-109
Sarmiento G. 1984 The ecology of Neotropical savannas. Harvard University Press, Cambridge, Massachusetts, USA
Solt M. L. J. J. Wurdack 1980 Chromosome numbers in the Melastomataceae. Phytologia 47: 199-220[Medline]
Swensen S. M. J. N. Luthi L. H. Rieseberg 1998 Datiscaceae revisited: monophyly and the sequence of breeding system evolution. Systematic Botany 23: 157-169
Swofford D. L. 1998 PAUP*. Phylogenetic analysis using parsimony (* and other methods). Sinauer, Sunderland, Massachusetts, USA
Triana J. J. 1871 Les Mélastomacées. Transactions of the Linnean Society, London 28: 1-188[Medline]
Whiffin T. S. Tomb 1972 The systematic significance of seed morphology in the Neotropical capsular-fruited Melastomataceae. American Journal of Botany 59: 411-422[CrossRef][ISI]
This article has been cited by other articles:
|
|
 |
|
  S. S. Renner Bayesian analysis of combined chloroplast loci, using multiple calibrations, supports the recent arrival of Melastomataceae in Africa and Madagascar Am. J. Botany, September 1, 2004; 91(9): 1427 - 1435. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
