|
|
||||||||
|
What's this? |
Systematics |
2Instituto de Ecología, A.C. Apartado Postal 63, 91000 Xalapa, Veracruz, Mexico; 3Departamento de Geografía, CUCSH, Universidad de Guadalajara, Av. de los Maestros y M. Bárcena, 44120 Guadalajara, Jalisco, Mexico; 4The Lewis B. and Dorothy Cullman Program for Molecular Systematics Studies, The New York Botanical Garden, 200th St. and Southern Blvd., Bronx, New York 10458-5126 USA
Received for publication September 11, 2003. Accepted for publication February 12, 2004.
| ABSTRACT |
|---|
|
|
|---|
Key Words: Crassulaceae ETS Graptopetalum ITS molecular rpl16 succulents trnL-F
| INTRODUCTION |
|---|
|
|
|---|
Crassulaceae is a family of approximately 35 genera that is divided into six subfamilies based on a variety of morphological characters (Berger, 1930
). However, according to recent molecular phylogenetic studies, there are only two major lineages in the family. One is the "Crassula lineage" that includes genera from three of the traditional subfamilies, Crassuloideae, Cotyledonoideae, and Kalanchoideae, which are found predominantly in southern Africa. The second is the "Sedum lineage" that includes genera from the other three subfamilies: Echeverioideae, Sedoideae, and Sempervivoideae. These are found predominantly in the Northern Hemisphere ('t Hart and Eggli, 1995
). One of the clades in the "Sedum lineage" has been informally named the "Acre clade" (van Ham and 't Hart, 1998
) and contains a group of genera from Echeverioideae as well as some species from the large genus Sedum L. (Sedoideae). According to Mort et al. (2001)
, the "Acre clade" comprises one-third of the species in Crassulaceae, but is plagued by a number of unresolved relationships.
Graptopetalum, a genus of about 19 species, is a member of the Acre clade (Mort et al., 2001
). The clade includes species representative of genera such as Cremnophila Rose, Echeveria DC., Pachyphytum Link, Klotzsch & Otto, Sedum, Tacitus Moran and Meyrán, and Thompsonella Britton & Rose (Mort et al., 2001
). With the exception of Sedum, which is a genus widely distributed, the rest of the taxa are restricted to North America. By focusing in Graptopetalum, in its phylogenetic postion as well as in its circumscription, a better understanding of the relationships of this American group will be gained. Two former species of Sedum were transferred to Graptopetalum (G. craigii and G. suaveolens). The study of this group will help evaluating the notoriously difficult "Sedum sensu lato" group.
Species of Graptopetalum are mostly found in semiarid vegetation from Arizona in the United States to Oaxaca in Mexico (Moran and Uhl, 1968
; Uhl, 1970
). The genus is traditionally divided into two sections based on stem characters. Section Byrnesia includes caulescent species, whereas section Graptopetalum includes acaulescent species with sessile leaf rosettes. This latter group occurs mainly in northwestern Mexico (Moran, 1984
).
A recent phylogenetic analysis of Graptopetalum using morphological characters (Acevedo-Rosas et al., 2004
) does not support the monophyly of the genus unless certain species of Sedum are transferred into Graptopetalum. Among a number of clades, two well-supported groups were recovered, one including the acaulescent species and another containing all the haplostemonous taxa. However, the question as to how many species should be recognized in Graptopetalum still remains.
The objective of this paper is to determine phylogenetic relationships among species of Graptopetalum using DNA sequence data from the nuclear ETS, ITS1, and ITS2 regions, as well as from the chloroplast genome in the form of the rpl16 intron and flanking regions, plus the trnL intron and trnL-F intergenic spacer. The resulting phylogenies will assist in determining if Graptopetalum is indeed monophyletic and to gain understanding in the relationships of the American group of Crassulaceae taxa part of the "Acre clade." Furthermore, we explore the utility of the ETS region as a potential source of variable characters to help resolve relationships within Crassulaceae.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA extraction, amplification, and sequencing
DNA was extracted from fresh or silica-gel-dried leaves using the modified 2x hexadecyltrimethylammonium bromide (CTAB) method of Doyle and Doyle (1990)
or the DNeasy Plant Mini kit (Qiagen, Hilden, Germany) for a few species. Leaf tissue was ground in liquid nitrogen before using CTAB. For ETS, the amplification and sequencing primers were 18S-ETS (Baldwin and Markos, 1998
) and a new primer designed specifically for Crassulaceae (ETS-IGSf). Baldwin and Markos (1998)
primers were used to obtain ETS sequences in one direction. Sequences were aligned and an internal ETS primer was then designed (ETS-IGSf: AGTTCACGTACGGCGGCCTTTTA). The primers used to amplify and sequence ITS were the universal primers ITS1 and ITS4 (White et al., 1990
); for rpl16, rpl16-1216F and rps3-42R (Asmussen, 1999); and for trnL-F, the universal primers cf (Taberlet et al., 1991
) (listed in Appendix 2; see supplemental data accompanying online version of this article). Polymerase chain reaction (PCR) fragments were purified using QIAquick silica columns (PCR purification kit, Qiagen) according to the manufacturer's protocols. These purified PCR products were sequenced in both directions using the BigDye Terminator Mix and an ABI 377 automated sequencer (Applied Biosystems, Foster City, California, USA) in the molecular systematics laboratories of The New York Botanical Garden.
Sequence alignment and phylogenetic analysis
Contigs were assembled using Sequencher 4.1 (Gene Codes, Ann Arbor, Michigan, USA). Sequence alignments for the four DNA regions were mostly unambiguous and were performed manually. Parsimony analyses were performed with PAUP* 4.0b10 (Swofford, 2002
). Three parsimony analyses were performed, ITS alone, ETS alone, and a combined analysis with all four DNA regions (ETS + ITS + rpl16 + trnL-F). A plastid alone analysis was not performed, because only a few informative characters were obtained for rpl16 and trnL-F. The number of taxa considered in each analysis varied. There were 43 taxa included for ITS, 41 taxa for ETS, and 31 taxa for the combined analysis. Heuristic searches were performed with 1000 random addition sequence replicates using tree bisection reconnection (TBR) branch swapping, MulTrees in effect, and with Fitch parsimony (Fitch, 1971
). Parsimony analyses weighted all characters and character-state transformations equally; gaps were treated as missing data. Support was evaluated through bootstrapping (Felsenstein, 1985
) with 550 replicates using TBR branch swapping for the combined matrix, and 50 000 replicates of fast stepwise-addition for the separate ETS and ITS data sets. Incongruence among data partitions (rpl16 + trnL-F and ETS + ITS) was evaluated with the partitionhomogeneity test of Farris et al. (1994)
implemented in PAUP* 4.0b10 (Swofford, 2002
). The partition homogeneity test used 1000 resamplings under the parsimony criterion with only variable characters included, all characters equally weighted.
| RESULTS |
|---|
|
|
|---|
|
Phylogenetic analyses
The partition homogeneity test (P < 0.18) identified incongruence among the two data sets (ETS + ITS and rpl16 + trnL-F). However, because none of the apparent conflict was between well-supported clades, the data were combined. The resulting cladogram from the ETS analysis had the greatest number of well supported-clades. Consensus of the 792 equally parsimonious trees is shown in Fig. 1. Graptopetalum is not monophyletic because some species are forming different groups with outgroup taxa such as Tacitus bellus, Cremnophila lingufolia, C. nutans, Echeveria fulgens, E. gibbiflora, and Sedum clavatum. Within this clade, the two species of Cremnophila, C. linguifolia and C. nutans, form a subclade with a bootstrap value of 66% and Echeveria fulgens is sister to Echeveria gibbiflora (100%). Some Graptopetalum species form well-supported subclades such as (1) G. glassi, G. superbum, and G. pentandrum; (2) G. bartramii and G. suaveolens; and (3) G. bernalense, G. paraguayense, and G. mendozae. Tacitus bellus is closely related to three Graptopetalum species: G. bartramii, G. suaveolens, and G. craigii (Fig. 1). Only trees 28 steps longer find Graptopetalum monophyletic.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
This study is also the first to employ rpl16 sequence data for Crassulaceae. The presence of a large deletion in this gene region (missing data equal to the complete intron) may have had a negative effect on the analysis, but it is present in taxa that appear to belong to different subclades according to the ITS, ETS, and combined trees. It seems to be a homoplasious character. In fact, loss of the intron was not even observed for closely related species of the same genus (e.g., Cremnophila nutans is missing the intron, but its sister species, C. ligulifolia, is not). This large deletion was found in eight species of Graptopetalum belonging to different subclades. In a preliminary analysis, we coded this deletion and other gaps as separate characters, as suggested by Simmons and Ochoterena (2000)
. However, this strategy had no effect on the overall tree topology.
Despite using the combination of four data sets, the number of parsimony-informative characters was still not sufficient to resolve all relationships among the taxa studied, and only a few subclades received bootstrap support (>50%). Mort et al. (2001)
suggested two possible reasons for finding so many unresolved polytomies in their phylogenetic study of the "Acre clade" of Crassulaceae. Their cladistic analysis used the chloroplast matK gene, and they mentioned the possibility that intergeneric hybridization could make for frequent chloroplast exchange among taxa, thus severely affecting chloroplast phylogenies. Two of the gene regions in our study, rpl16 and trnL-F, are from the chloroplast genome. Furthermore, a variable chromosome number has been reported for 11 Graptopetalum species, ranging from n = 30 to 270 (Uhl, 1970
). This large variation in chromosome numbers is indicative of polyploidy and hybridization. However, polyploidy has never been evaluated in a scientific manner in Graptopetalum. Crassulaceae is easily hybridized in cultivation, but there is no empirical evidence for the hybrid origin of any of the species, and nearly all Graptopetalum species were wild collected. One reason that both plastid and nuclear genes were chosen was to look for obvious evidence for such a phenomenon in the resulting trees, but this was not found. Moreover, the current geographic distribution and isolation of the species (with the exception of one widespread species) tend to favor against hybrid origins.
Mort et al. (2001)
also considered that the "Acre clade" is a group of relatively recent origin, and this would account for the low levels of variation as seen in our results as well. In our study, incongruence between data partitions was restricted to the positions of only three species of Graptopetalum: G. grande, G. pusillum, and G. saxifragoides. However, their alternative positions did not receive strong bootstrap support, suggesting soft rather than hard conflicting phylogenetic signal.
In the combined DNA analysis, we recovered a topology in which at least three major clades of Graptopetalum are evident. Within these clades, only four smaller subgroups of Graptopetalum species receive bootstrap support (>50%), but these largely correlate with the geographic distribution of the species. Graptopetalum glassii, G. superbum, and G. pentandrum form a well-supported clade that is also present in all most parsimonious trees obtained with ETS and ITS data sets alone. Morphological analyses (Acevedo-Rosas and Cházaro, 2003
; Acevedo-Rosas et al., 2004
) also recover this monophyletic group, which is characterized by flowers with only one whorl of stamens. These three species are confined to the states of Colima, Jalisco, and Michoacán in west-central Mexico. They appear to be closely related to species of Cremnophila, Echeveria, and Sedum, as well as other Graptopetalum species such as G. fruticosum and G. marginatum, which are also from the west-central Mexican states of Jalisco and Nayarit. The second supported subclade consists of G. bernalense, G. paraguayense, and G. mendozae. These three species are geographically restricted to the states of Tamaulipas and northern Veracruz in east-central Mexico. The third subclade contains Tacitus bellus, Graptopetalum bartramii, G. suaveolens, and G. craigii. These species are restricted to Sonora, Chihuahua, and Durango in northwestern Mexico and are sister to the pair of G. filiferum and G. rusbyi, which are also restricted in their range to the extreme northwest of Mexico and Arizona. This clade of six species is sister to another group of species, G. pusillum, G. saxifragoides (both from Durango as well), and the widespread G. pachyphyllum.
These subclades do not correspond to the two sections of Graptopetalum defined by Moran (1984)
. Species placed in section Byrnesia (caulescent species) as well as those classified in section Graptopetalum (acaulescent species) are distributed throughout the cladogram. For example, the acaulescent species G. marginatum is sister to G. fruticosum, one of the caulescent species. If we are to accept these gene tree topologies, then the separate lineages of Graptopetalum species cannot be characterized by those morphological characters that Acevedo-Rosas et al. (2004)
found to be synapomorphic. Among these characters are habit, flower fragrance, color of petals, and position of petal maculae. Tacitus bellus has large flowers with colorful, dark pink petals that lack spots. It is also aromatic and grouped with G. bartramii, G. suaveolens, and G. craigii, all of which have whitish petals. It seems, therefore, that geography rather than habit or flower morphology may be a better indicator of phylogenetic relationships within this group. The acaulescent and caulescent habits appear to have evolved independently from ancestors native to different geographic areas, perhaps to fill vacant ecological niches within each of these isolated environments. Most Graptopetalum species are found in semiarid vegetation, and populations are usually isolated on rocky hills of ravines in these habitats (Acevedo-Rosas et al., 2004
).
Our results clearly indicate that Graptopetalum is not monophyletic as currently circumscribed (trees 28 steps longer find the genus monophyletic). However, they do not conclusively indicate the exact composition of the genus. The type species of the genus is G. pusillum, but this species is in a group that did not receive bootstrap support (>50%). Cremnophila and apparently some species of Sedum and Echeveria are embedded within Graptopetalum, but we have not sampled those large genera well enough to know which ones and how many. The monotypic genus Tacitus (T. bellus) is also embedded within Graptopetalum and probably should not be considered a separate genus. As mentioned, T. bellus has been difficult to classify because of its unique and horticulturally prized flowers, which are almost certainly not fly-pollinated as are most Graptopetalum species. Tacitus bellus has been considered a species of Graptopetalum by some authors (Hunt, 1979
), and its close relationship to G. suaveolens in our trees is supported by their similar aromatic floral fragrance.
Shifts in pollinator syndromes (e.g., from fly to bee) leading to convergent flower morphologies have been documented in many other groups of flowering plants (e.g., Hapeman and Inoue, 1997
; Borba et al., 2002
). These shifts may help to explain the patterns observed in Graptopetalum as well. Variation in color and distribution of bands over petals and dissimilar fragrances in same groups of Graptopetalum suggest that different pollinator syndromes exist. However, due to the remote places in which most Graptopetalum species grow, no evidence on pollination biology has been gathered.
More data from additional gene regions with high levels of variation are needed ultimately to address the question of which species should be included in Graptopetalum. Greater taxon sampling is needed as well, especially from within the large and problematic genera Echeveria and Sedum within the "Acre" clade. Nevertheless, this study sheds new light on interpretations of systematic relationships within Crassulaceae and the role that geography, habitat, pollinators, and other ecological factors may play in driving the evolution of these succulents.
| FOOTNOTES |
|---|
5 E-mail: victoria{at}ecologia.edu.mx ![]()
| LITERATURE CITED |
|---|
|
|
|---|
Acevedo-Rosas R. V. Sosa F. G. Lorea 2004 Phylogenetic relationships and morphological patterns in Graptopetalum (Crassulaceae). Brittonia 56: 185194 [CrossRef][Web of Science][Medline]
Andreasen K. B. G. Baldwin 2003 Reexamination of relationships, habitat evolution and phylogeography of checker mallows (Sidalcea; Malvaceae) based on molecular phylogenetic data. American Journal of Botany 90: 434-444
Assmussen C. B. 1999 Toward a chloroplast DNA phylogeny of the Tribe Geonomeae (Palmae). Memoirs of the New York Botanical Garden 83: 121-129[Web of Science]
Baldwin B. G. S. Markos 1998 Phylogenetic utility of the external transcribed spacer (ETS) of 18S-26S rDNA: congruence of ETS and ITS trees of Calycadenia (Compositae). Molecular Phylogenetics and Evolution 10: 449-463[CrossRef][Web of Science][Medline]
Beardsley P. M. R. G. Olmstead 2002 Redefining Phrymaceae: the placement of Mimulus, tribe Mimuleae, and Phryma. American Journal of Botany 89: 1093-1102
Berger A. 1930 Crassulaceae. In A. Engler and K. Prantl [eds.], Die Natürlichen Pflanzenfamilien, 2nd ed, 352482. Wilhelm Engelmann, Leipzig, Germany
Borba E. L. G. J. Shepherd C. van den Berg J. Semir 2002 Floral and vegetative morphometrics of five Pleurothallis (Orchidaceae) species: correlation with taxonomy, phylogeny, genetic variability and pollination systems. Annals of Botany 90: 219-230
Bremer B. R. K. Jansen B. Oxelman M. Backlund H. Lantz K.-J. Kim 1999 More characters or more taxa for a robust phylogeny case study from the coffee family (Rubiaceae). Systematic Biology 48: 413-435[CrossRef][Web of Science][Medline]
Clevinger J. A. J. L. Panero 2000 Phylogenetic analysis of Silphium and subtribe Engelmanninae (Asteraceae: Heliantheae) based on ITS and ETS sequence data. American Journal of Botany 87: 565-572
Doyle J. J. J. L. Doyle 1990 Isolation of plant DNA from fresh tissue. Focus 12: 13-15
Farris J. S. M. Källersjo A. G. Kluge C. Bult 1994 Testing significance of incongruence. Cladistics 10: 315-319[CrossRef][Web of Science]
Felsenstein J. 1985 Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791[CrossRef][Web of Science]
Fitch W. M. 1971 Toward defining the course of evolution: minimum change for a specific topology. Systematic Zoology 20: 406-416[CrossRef][Web of Science]
Gehrig H. O. Gaubmann H. Marx D. Schwarzott M. Kluge 2001 Molecular phylogeny of the genus Kalanchoe (Crassulaceae) inferred from nucleotide sequences of the ITS-1 and ITS-2 regions. Plant Science 160: 827-835
Graybeal A. 1998 Is it better to add taxa or characters to a difficult phylogenetic problem?. Systematic Biology 47: 9-17
Hapeman J. K. Inoue 1997 Plant-pollinator interactions and floral radiation in Platanthera (Orchidaceae). In T. J. Givnish and K. J. Sytsma [eds.], Molecular evolution and adaptive radiation, 433454. Cambridge University Press, Cambridge, UK
Hillis D. M. 1998 Taxonomic sampling, phylogenetic accuracy, and investigator bias. Systematic Biology 47: 3-8
Hunt D. R. 1979 Graptopetalum bellum. Botanical Magazine 182: 130[Medline]
Jorgensen T. H. J. Frydenberg 1999 Diversification in insular plants: inferring the phylogenetic relationship in Aeonium (Crassulaceae) using ITS sequences of nuclear ribosomal DNA. Nordic Journal of Botany 19: 613-621[CrossRef][Web of Science][Medline]
Moran R. 1984 Graptopetalum rusbyi (Greene) Rose and G. occidentale Rose (Crassulaceae). Cactus and Succulent Journal 56: 169-176[Medline]
Moran R. C. H. Uhl 1968 Graptopetalum fruticosum a new species from Jalisco, Mexico. Cactus and Succulent Journal 40: 152-156[Medline]
Mort M. E. D. E. Soltis P. S. Soltis J. Francisco-Ortega A. Santos-Guerra 2001 Phylogenetic relationships and evolution of Crassulaceae inferred from matK sequence data. American Journal of Botany 88: 76-91
Mort M. E. D. E. Soltis P. S. Soltis J. Francisco-Ortega A. Santos-Guerra 2002 Phylogenetics and evolution of the Macaronesian Clade of Crassulaceae inferred from nuclear and chloroplast sequence data. Systematic Botany 27: 271-288[Web of Science]
Simmons M. P. H. Ochoterena 2000 Gaps as characters in sequence-based phylogenetic analyses. Systematic Biology 49: 369-381[CrossRef][Web of Science][Medline]
Soltis D. E. P. S. Soltis M. E. Mort M. W. Chase V. Savolainen S. B. Hoot C. M. Morton 1998 Inferring complex phylogenies using parsimony: an empirical approach using three large DNA data sets for angiosperms. Systematic Biology 47: 32-42
Swofford D. L. 2002 PAUP*. Phylogenetic analysis using parsimony (* and other methods). Version 4.0b10. Sinauer Associates, Sunderland, Massachusetts, USA
Taberlet P. L. Gielly G. Pautou J. Bouvet 1991 Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105-1109[CrossRef][Web of Science][Medline]
't Hart H. U. Eggli [eds.] 1995 Evolution and systematics of the Crassulaceae. Backhuys, Leiden, Netherlands
't Hart H. R. D. H. J. van Ham J. F. Stevens E. T. Elema H. van der Klis T. W. J. Gadella 1999 Biosystematic, molecular and phytochemical evidence for the multiple origin of sympetaly in Eurasian Sedoideae (Crassulaceae). Biochemical Systematics and Ecology 27: 407-426[CrossRef]
Uhl C. H. 1970 Chromosomes of Graptopetalum and Thompsonella (Crassulaceae). American Journal of Botany 85: 123-134
Van Ham R. C. H. J. H. 't Hart 1998 Phylogenetic relationships in the Crassulaceae inferred from chloroplast DNA restriction site variation. American Journal of Botany 85: 123-134[Abstract]
Van Ham R. C. H. J. H. 't Hart T. H. M. Mes J. M. Sandbrink 1994 Molecular evolution of noncoding regions of the chloroplast genome in the Crassulaceae and related species. Current Genetics 25: 558-566[CrossRef][Web of Science][Medline]
White T. J. T. Bruns S. Lee J. Taylor 1990 Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M. Innis, D. Gelfand, J. Sninsky, and T. White [eds.], PCR protocols: a guide to methods and applications, 315322. Academic Press, San Diego, California, USA
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Facebook
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
Y. Mitsui, S.-T. Chen, Z.-K. Zhou, C.-I. Peng, Y.-F. Deng, and H. Setoguchi Phylogeny and Biogeography of the Genus Ainsliaea (Asteraceae) in the Sino-Japanese Region based on Nuclear rDNA and Plastid DNA Sequence Data Ann. Bot., January 1, 2008; 101(1): 111 - 124. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |