Am. J. Bot.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


  Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter
What's this?
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chat, J.
Right arrow Articles by Nadot, S.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Chat, J.
Right arrow Articles by Nadot, S.
Agricola
Right arrow Articles by Chat, J.
Right arrow Articles by Nadot, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
(American Journal of Botany. 2004;91:736-747.)
© 2004 Botanical Society of America, Inc.


Systematics

Reticulate evolution in kiwifruit (Actinidia, Actinidiaceae) identified by comparing their maternal and paternal phylogenies1

Joëlle Chat2,5, Blanca Jáuregui2, Rémy J. Petit3 and Sophie Nadot4

2Unité de Recherches sur les Espèces Fruitières et la Vigne, Institut National de la Recherche Agronomique, B. P. 81, F-33883 Villenave d'Ornon cedex, France; 3UMR Biodiversité, Gènes et Ecosystèmes, 69 route d'Arcachon, F-33610 Cestas cedex, France; 4Laboratoire Ecologie, Systématique et Evolution, CNRS UMR 8079, Université Paris-Sud, F-91405 Orsay cedex, France

Received for publication May 6, 2003. Accepted for publication January 8, 2004.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Evolutionary relationships within Actinidia, a genus known for the contrasting mode of inheritance of its plastids and mitochondria, were studied. The phylogenetic analysis is based on chloroplast (cp) and mitochondrial (mt) restriction site and sequence data (matK, psbC-trnS, rbcL, and trnL-trnF for cpDNA; nad1-2/3 and nad4-1/2 for mtDNA). The analysis of cp sequence data confirms the hypothesis that the four currently recognized sections are not monophyletic. The detection of incongruences among phylogenies (mtDNA vs. cpDNA tree) coupled with the detection of intraspecific polymorphisms confirms some of the reticulations previously emphasized, diagnoses new hybridization/introgression events, and provides evidence for multiple origin of at least two polyploid taxa. A number of hybridization/introgression events at the diploid, tetraploid, and possibly hexaploid levels are documented. The extensive reticulate evolution undergone by Actinidia could account for the lack of clear morphological discontinuities at the species level.

Key Words: chloroplast microsatellites • hybridization • mitochondrial indels • molecular phylogeny • multiple origin of polyploids


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
A plant cell typically hosts one nuclear and two organellar genomes (chloroplast and mitochondrial). The choice for molecular phylogenetic studies in the last decade has been the chloroplast genome. The nuclear genome has been relatively little used, in part due to the problem of distinguishing orthologous from paralogous genes (Olmstead and Palmer, 1994 ). Similarly, the mitochondrial genome has been relatively neglected as a source of phylogenetic data for plants because of its high degree of intramolecular recombination and its low rate of base substitution, except to investigate the relationships among phylogenetically distant lineages (Hiesel et al., 1994 ; Bowe et al., 2000 ; Chaw et al., 2000 ). This situation has changed in the last few years with a growing number of intrageneric or even intraspecific phylogenetic studies, including information from the mitochondrial genome (e.g., Ronfort et al., 1995 ; Cho et al., 1998 ; Dumolin-Lapègue et al., 1998 ; Bakker et al., 2000 ; Freudenstein and Chase, 2001 ; Anderberg et al., 2002 ).

In most plant species, both the chloroplast and the mitochondrial genomes are inherited from the mother. However, some plant species are known to transmit recurrently their mitochondrial and chloroplast genomes through opposite sexual partners. Such contrasting modes of organelle inheritance are found in several gymnosperms (Neale and Sederoff, 1989 ) and are also found in some angiosperms, e.g., Musa (Fauré et al., 1994 ) and Cucumis (Havey et al., 1998 ). In such cases, the mitochondrial genome becomes particularly interesting for phylogenetic and population genetic purposes because both maternal and paternal genetic lineages can be simultaneously traced (e.g., Wang et al., 2000 ). Investigating whether maternal, paternal, and biparental (nuclear-based) phylogenies reflect the same evolutionary history, i.e., species history, is thus possible for these plant groups. Incongruences between a chloroplast gene tree and a mitochondrial gene tree will be especially informative in the context of a plant group subject to hybridization and polyploidization. They allow the distinction between allopolyploidy (merger of two fully differentiated nuclear genomes) and autopolyploidy (doubling of a single nuclear genome). When both organelles are maternally inherited as in most plant species, an allopolyploid speciation results in the merger of two differentiated nuclear genomes in the maternal cytoplasm (Wendel, 2000 ). When organellar genomes have a contrasting and uniparental mode of inheritance, cytoplasmic genomes reflect the allopolyploidization process, too, with each parent species contributing one organellar genome.

Actinidia is an angiosperm plant genus well documented for its paternal mode of chloroplast inheritance and its maternal mode of mitochondrial inheritance (Cipriani et al., 1995 ; Testolin and Cipriani, 1997 ; Chat et al., 1999 ). The genus Actinidia, whose name reflects the peculiar radiating arrangement of the styles, consists of perennial, climbing or straggling, deciduous, and dioecious plants. Actinidia belongs to the family Actinidiaceae together with the genera Saurauia and Clematoclethra (Dickison, 1972 ; Dickison et al., 1982 ). It occurs in Asia with a main center of diversity in southwestern China (Liang, 1983 ). Some of the species, such as A. polygama, A. arguta, and A. chinensis, have broad distributions, from Japan through northeastern Asia to western China (Li, 1952 ), and exhibit geographical varieties. However, most species have more restricted ranges (Liang, 1983 ). A subdivision of the genus Actinidia was first proposed by Dunn (1911) . Following this first attempt, Li (1952) , Liang (1983) , and Cui et al. (2002) successively proposed revisions (Table 1). Approximately 40 new species were described following botanical explorations undertaken during the 20th century and added to the 24 species recognized by Dunn. Even during the past decade additional taxa have been described by Chinese botanists (e.g., Shi et al., 1994 ). Likewise, some taxa formerly considered as varieties were later raised to species status, as in the case of A. deliciosa and A. setosa, which were previously considered as varieties of A. chinensis (Liang and Ferguson, 1986 ). The last survey conducted in China led to the description of 62 species, 57 of which have been classified in infrageneric sections (Cui et al., 2002 ). Actinidia is currently divided into four infrageneric sections, namely, Leiocarpae, Maculatae, Stellatae, and Strigosae, on the basis of fruit (presence or absence of lenticels), pith (lamellate or nonlamellate), and hair (simple or stellate) characteristics (Cui et al., 2002 ). All the available cytogenetic data suggests a base chromosome number of x = 29 for the genus (Zhang and Beuzenberg, 1983 ; McNeilage and Considine, 1989 ). In the sections Leiocarpae and Stellatae, tetraploid and hexaploid forms occur in addition to the diploid ones (Hopping, 1994 ). Infraspecific variation in chromosome number appears to be common (Yan et al., 1997 ). Previous molecular phylogenetic studies of infrageneric relationships in Actinidia based on chloroplast and nuclear data indicate that the current classification does not reflect the evolutionary history of the genus (Testolin and Ferguson, 1997 ; Cipriani et al., 1998 ; Li et al., 2002 ). Furthermore, the systematic position of the family Actinidiaceae has long been unresolved, being included successively within different orders, e.g., the Dilleniales (Lindley, 1836 ), the Theales (Schmid, 1978 ; Cronquist, 1981 ), or the Ericales (Takhtajan, 1980 ). Cladistic analyses based on morphological, anatomical, and embryological features suggested that the family Actinidiaceae is basal within the Ericales (Judd and Kron, 1993 ), a placement which was then confirmed by chloroplast molecular data (Kron and Chase, 1993 ; Morton et al., 1997 ; Anderberg et al., 2002 ).


View this table:
[in this window]
[in a new window]
 
Table 1. Historical comparison of the four main Actinidia taxonomic classifications

 
To understand the evolutionary history of the genus Actinidia, we compared the cpDNA and mtDNA phylogenies of most of the Actinidia species currently available in European and Chinese repositories. The reconstruction of the chloroplast genome history was mainly based on sequence data from two regions expected to evolve at contrasting rates: rbcL, a protein- coding gene, and the trnL-trnF region, which includes an intron and an intergenic spacer. For the mitochondrial genome, we examined variation in two mitochondrial introns, which are expected vary more than the extremely conserved exons and which have been previously used to demonstrate the uniparental maternal mode of inheritance of the mitochondrial genome in Actinidia (Testolin and Cipriani, 1997 ). The first one is located between exon 2 and exon 3 of subunit I of NADH dehydrogenase (nad1-2/3). The second is located between exon 1 and exon 2 of subunit IV of the same enzyme (nad4-1/2). Both regions were amplified by polymerase chain reaction (PCR) and subjected to restriction site analysis. By relying on both the maternal and the paternal lineages, we tried to elucidate relationships within Actinidia, to establish whether both the paternal and the maternal phylogeny support the current morphologicallybased classification, to track hybridization events, and to infer the nature of the polyploidization processes that have affected this genus. In addition, we tried to clarify species relationships among the two cultivated species A. chinensis and A. deliciosa and their close relative A. setosa.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Taxon sampling
Leaf material from 40 taxa representing 30 of the 62 currently recognized species of Actinidia (Cui et al., 2002 ) were selected from European and Chinese collections. A total of 79 samples were collected. Vouchers were deposited at HIB for three specimens from Chinese collections (Li et al., 2002 ) and at P for 18 specimens from French collections. Repeated attempts to obtain additional plant material to deposit in herbaria failed. A preliminary study involving all 79 Actinidia samples was conducted to estimate the level of polymorphism among and within species. Afterward, a subsample of 41 accessions plus two outgroups (Saurauia and Clematoclethra, the two other genera of Actinidiaceae) were chosen for rbcL and trnL-trnF sequencing (listed in Appendix 1; see Supplemental Data accompanying the online version of this article). Emphasis was placed on the section Stellatae and especially on A. chinensis and A. deliciosa, owing to their economic importance.

DNA isolation, amplification, and digestion
Total genomic DNA was isolated from leaf tissue according to a modified cetyltrimethylammonium bromide (CTAB) procedure (Chat et al., 1999 ). To evaluate inter- and intraspecific variation, three cpDNA regions, i.e., an exon (rbcL), an intron (matK), and an intergenic spacer (psbC-trnS), and two mtDNA introns (nad1-2/3 and nad4-1/2), were amplified using PCR and subsequently digested with eight four-base restriction enzymes (AluI, HhaI, HinfI, MspI, NdeII, RsaI, TaqI, Tru1I). Only losses and gains of restriction sites were scored for cpDNA.

DNA sequencing
One plant per haplotype was further sequenced to determine unambiguously the relative positions of both the restriction sites and the indels, except for matK, for which several Actinidia sequences had already been published. In addition, the 42 accessions selected were sequenced for both a coding and a noncoding cpDNA (rbcL, trnL intron, and trnL-trnF intergenic spacer). The primers for PCR amplification and for sequencing were as follows: rbcL (5' TTGGCAGCATTCCGAGTAA 3'; 5' TGTCCTAAAGTTCCTCCAC 3'), matK (5' GTACTTGCTCATGATCATGG 3'; 5' CTAGCAAAGAAAGTCGAAG 3'), psbC, and trnS (Demesure et al., 1995 ), trnL- trnF "c," "d," "e," and "f" (Taberlet et al., 1991 ), nad1-2/3, and nad4-1/2 (Demesure et al., 1995 ). Additional primers were designed to achieve complete sequencing: rbcL (5' GGGAGTTCACGTTCTCATCA 3'; 5' GGCATTACTTGAATGCTACTG 3'), psbC-trnS (5' CGGAGGACATGTATGGTTAG 3'), nad1-2/3 (5' GGCAACAAATGTTGAGCATAC 3'), nad4-1/2 (5' CCCGACCAGGGATGGACG 3'; 5' CCAACCCATTTGGACCCCTT 3'). The PCR amplification conditions were as described in the references mentioned earlier. Double-strand sequencing was performed directly from PCR amplification products for rbcL and trnL-trnF. Sequence contigs were assembled and completed sequences have been deposited in the EMBL (European Molecular Biology Laboratory) database.

Phylogenetic analyses
Chloroplast data
Multiple alignments of the sequences were obtained using the Clustal X program (Thompson et al., 1997 ) and checked manually. Insertions/deletions (indels) in the trnL-trnF alignment were coded using the method of Simmons and Ochoterena (2000) implemented in the program GapCoder (http://www.trinity.edu/nyoung/GapCoder) and appended to the trnL-trnF sequence matrix. Phylogenetic analyses were all performed using PAUP* 4.0b10 (Swofford, 1998 ). The three chloroplast data sets, i.e., restriction sites, (rbcL, matK, and psbC-trnS), rbcL sequences, and trnL-trnF sequences (with gaps either coded or ignored) were analyzed separately or combined, except for the rbcL restriction sites that were discarded to avoid redundancy with rbcL sequences. Parsimony analyses used heuristic searches with 1000 random addition replicates, tree bisection-reconnection (TBR), branch swapping, MulTrees on, with all character states unordered and equally weighted, and gaps coded as previously described. The congruence of the rbcL and trnL-trnF sets was assessed using incongruence length difference (Farris et al., 1995 ) calculated using the partition homogeneity test in PAUP*. This test was performed with 100 replications of the heuristic search. Strict and majority-rule consensus trees were calculated from all most parsimonious trees. The robustness of nodes was inferred by a bootstrap analysis (Felsenstein, 1985 ) of 1000 replicates of the heuristic search on the combined data set and by calculating decay values (Bremer, 1994 ) with Autodecay 4.0 (Eriksson, 1999 ). To explore alternative hypotheses of relationships, additional heuristic searches were performed using the option "enforce topological constraints." The g1 statistic was calculated using all the characters on a subset of 12 Actinidia taxa representing the major clades of the strict consensus tree. Characters of the combined data set were also successively weighted (Farris, 1969 ) based on the rescaled consistency index (RC), a base weight of 1000, and their maximum value if more than one tree was found. Subsequently, a heuristic search was performed with the same options as previously described except for character weight. Successive rounds of weighting/searching were performed until in two successive rounds the same tree length was obtained. To explore more fully the sister-species relationships within Leiocarpae, a parsimony analysis by unweighted exhaustive search was also performed on a reduced data set of 12 taxa using the same options as described earlier.

Mitochondrial data
For nad4-1/2, the three gaps identified have been coded with a "1" for present and a "0" for missing (Young and Healy, 2003 ) using the "simple indel coding" method of Simmons and Ochoterena (2000) implemented in the program GapCoder. For the polymorphic region of nad1- 2/3, the number and the position of gaps required to maintain positional homology were uncertain due to nested and overlapping indels. Some of the length variations appeared to be repeats of adjacent sequences, and manual revision of the alignment therefore led to several alternative alignments. Assigning a relative cost of mismatches (nucleotide substitution vs. insertion of a gap) remains basically arbitrary (Wheeler et al., 1995 ). In particular, we found no justification to prefer one particular alignment among all multiple equally optimal alignments and to speculate on how indels are evolutionarily related to one another. Consequently, we chose an indel-coding method that requires no assumption of state changes. This method, favored by Freudenstein and Chase (2001) when reconstructing nad1-2/3 mitochondrial phylogeny of Orchidaceae, used a single multistate unordered character (each different gap string coded as a state of the character) whenever nested or overlapping gap strings are found. A parsimony exhaustive search was then performed on the mitotype matrix containing gap information.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Chloroplast data
Restriction sites
A total of 26 variable restriction sites were revealed among the 80 accessions (79 from Actinidia and one from Clematoclethra; details are available in Appendixes 2 and 3 in Supplemental Data accompanying the online version of this article), respectively, four for rbcL (1118 bp), 15 for matK (1221–1227 bp), and seven for psbC-trnS (1604–1615 bp). Among them, 10 restriction site mutations were autapomorphies, three for Clematoclethra and seven for Actinidia. Of the 21 Actinidia species represented by at least two accessions, eight species had intraspecific restriction site variation. The level of variation displayed by restriction site analysis of the rbcL region suggested that this region was likely to be phylogenetically informative, and nearly complete sequencing was performed. When several accessions were available within a taxon (species or variety), only one accession representing the most common restriction profile for that taxon was sequenced (listed in Appendix 1).

Sequences
The region of the rbcL gene analyzed here comprised 1000 characters (corresponding to base positions 174–1173 of the rbcL sequence of Nicotiana tabacum L.). Among the 49 variable sites, 32 (65%) were phylogenetically informative (Table 2). Parsimony analysis of the rbcL matrix yielded 11 equally parsimonious trees of 65 steps, consistency index (CI) excluding uninformative sites = 0.79 and retention index (RI) = 0.91. Lengths of the trnL-trnF sequences prior to alignment varied from 913 to 931, 957 being the final length of the alignment. The region spanning the trnL intron and the trnL-trnF intergenic spacer displayed simple sequence repeats (SSR) and several indels of 4–8 bases, representing additional variable characters. The SSRs, prone to homoplasy (Doyle et al., 1998), were subsequently excluded from the phylogenetic analyses, whereas any parsimony-informative indels were treated as binary characters and appended to the trnL-trnF sequence matrix. Of the 84 substitutions in the trnL-trnF alignment, 37 (44%) were informative. The trnL-trnF parsimony analyses produced five equally parsimonious trees of 107 to 96 steps depending on whether gaps were included or not. Including gap codes in the trnL-trnF sequence matrix did not modify the topology of the strict consensus tree (data not shown) and increased the RI slightly (Table 2). The partition– homogeneity test indicated that the two sequence matrices were not statistically incongruent (P = 0.07). The majority rule consensus tree of rbcL and that of trnL-trnF both displayed several polytomies. The only substantial incongruence between the two topologies was the placement of A. rufa: in the rbcL tree, A. rufa fell within a well-supported clade containing A. cylindrica, A. styracifolia, A. latifolia, and three accessions of A. eriantha, whereas it was sister to the group formed by A. hemsleyana, A. zhejiangensis, and A. persicina in the trnL-trnF tree.


View this table:
[in this window]
[in a new window]
 
Table 2. Comparison of lengths and indices for the analyses of separate and combined chloroplast data sets for Actinidia. CI and RI are the consistency and retention indices, respectively

 
Combined analysis
The combined data matrix had 1990 characters (1957 from sequences, 11 from trnL-trnF gaps, and 22 from restriction sites), of which 165 characters are variable and 86 potentially phylogenetically informative. As suggested by the shape of tree length distribution (g1 statistic = –0.88), there is some phylogenetic signal in the data. Parsimony analysis of this combined data matrix resulted in one island of four equally parsimonious trees of 202 steps (CI = 0.84, RI = 0.91), which have the same topology except for the placement of A. arguta, A. melanandra, and A. kolomikta. One of them is shown in Fig. 1. The state changes in indels and SSRs in the trnL-trnF alignment are indicated on the tree. As expected, one of the three trnL-trnF phylogenetically informative SSRs (ID3) appears to be highly homoplasic with the same insertion appearing three times independently. In contrast, the other type of insertions and deletions map unambiguously as synapomorphies with only one state change. This tree (Fig. 1), as well as the strict consensus tree (Fig. 2), has two major clades. Most of the accessions (14 of 20) included in clade I are from the section Stellatae, whereas clade II, which is more strongly supported, includes a well-balanced number of Maculatae and Stellatae accessions. The sections Stellatae and Maculatae appear therefore polyphyletic. Actinidia hemsleyana, one of the only two Strigosae species examined in this study, is embedded within clade I, whereas the other one, A. melliana, falls into clade II. Actinidia rufa is placed in clade I, far from the seven Leiocarpae species. Leiocarpae forms a paraphyletic group with four clades at the base of the tree, although it is the most clear-cut section in terms of morphological characters. Successive weightings produced three trees differing only slightly by the placement of A. kolomikta. The combination of these three trees as a strict consensus tree is similar in topology to the strict consensus tree of the unweighted analysis shown in Fig. 2. The only difference is the placement of the clade formed by A. arguta and A. melanandra, which is unresolved in the unweighted analyses, whereas it appears basal to the remaining species of the genus in the successive weighting analyses. The unweighted exhaustive parsimony analysis focusing on Leiocarpae yielded four most parsimonious trees (151 steps long, CI = 0.88, RI = 0.82). The section Leiocarpae appears paraphyletic in all these four trees (strict consensus tree in Fig. 3).



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 1. One of four most parsimonious trees resulting from a heuristic search of 41 sequences (rbcL and trnL-trnF) and restriction sites (matK and psbC- trnS) of 30 Actinidia species. The two other recognized genus of the Actinidiaceae, namely Clematoclethra and Saurauia, served as outgroups. Length = 202 steps, consistency index = 0.84, retention index = 0.91. Branch lengths are proportional to the number of changes. Transitions in the seven informative indels of trnL-trnF sequences (ID1–7) are indicated on the phylogram by dotted bars. In the phylogenetic reconstruction, ID1, ID3, and ID4 (SSRs) were treated as missing (underlined on the phylogram), and ID2 and ID5–7 (indels) were coded as additional characters. The polarity inferred was as follows (I for insertion, D for deletion): D2 is a deletion of 8 bp, D5 is a 4-bp deletion, and I6 and I7 represent each a 5-bp insertion. Asterisks indicate branches collapsing in the strict consensus. The sections of the classification of Liang (1983) are listed (Lei, Leiocarpae; Mac, Maculatae; Ste, Stellatae; Str, Strigosae)

 


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 2. Strict consensus of the four equally parsimonious trees of 40 taxa from 30 Actinidia species based on chloroplast (rbcL and trnL-trnF) sequences and restriction site (matK and psbC-trnS) data. Numbers below branches refer to decay index and numbers above branches indicate bootstrap proportions (>50%) from 1000 replicates. Both ploidy and mtDNA haplotype (underlined), which occurred within each sequenced individual, are listed after species and variety names, followed by mitotypes detected in conspecies additional samples. Black and shaded bars indicate plesiomorphic and apomorphic mitotypes, respectively. Symbols are used to label several taxa of the same taxonomic species. Taxa with a probable reticulate origin deduced from distant related ITS sequences (Li et al., 2002 ) are indicated in boldface type

 


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3. Strict consensus of the four equally parsimonious trees obtained following an exhaustive search. Length = 151 steps, consistency index = 0.88, retention index = 0.82. The sudivisions of the classification of Liang (1983) are listed. The section Leiocarpae appears paraphyletic. Black and shaded bars indicate plesiomorphic and apomorphic mitotypes, respectively

 
Monophyly constrained analyses
Constrained searches reveal that an extra 34 and 33 steps, respectively, are needed to force the two well-represented sections Maculatae and Stellatae to be monophyletic. In the section Leiocarpae, our data support the monophyly of the series Lamellatae but not that of the other series, namely Solidae, which would need at least three additional steps to be achieved. However, once the series Solidae is constrained to be monophyletic, no additional step is required for the entire section Leiocarpae to be monophyletic.

Mitochondrial data
No mutational loss or gain of restriction sites was found in either nad1-2/3 or in nad4-1/2. However, seven indels were found among the 80 accessions. Partial sequencing and alignment further helped to identify each of the eight mitotypes formerly observed on restriction profiles by their exact length, base composition, and position of each insertion/deletion event (Table 3). However, partial sequencing failed to reveal additional parsimony-informative nucleotide substitutions among mitotypes. The three indels observed within nad4-1/2 are distant by 200–300 bases, whereas all four indels within nad1-2/3 are located at the same median position in the amplicon. Polymorphisms among mitotypes often involved repeats of DNA motifs 5–6 bases long (Table 3), with a number of copies ranging from two (mitotypes B, C, E, F, G) to three (mitotype H).


View this table:
[in this window]
[in a new window]
 
Table 3. Description of the eight distinct mitotypes found in this study for Actinidia (NA: not available). Flanking regions are in lowercase letters when it could help to understand the origin of the indels. The sequences of the flanking regions of nad1-2/3 indels have been used to modify substantially the algorithmic alignment, and the alignment shown here is one of the many equally optimal alignments

 
The equally weighted parsimony analysis conducted on the mitotype matrix yielded 37 equally parsimonious trees. The strict consensus tree resulted in a large polytomy linking all the eight mitotypes (data not shown). As a consequence, we simply decided to map the mitotypes onto the chloroplast- based strict consensus tree, in the same way that we did for the ploidy levels (Fig. 2). Among the eight mitotypes identified, mitotype C, the three mitotypes A, E, and F, and mitotype H appeared to be series-, species-, and clone-specific, respectively (Fig. 2). Furthermore, three mitotypes (B, C, and E) were typical of the section Leiocarpae. Mitotype G is found mainly in A. chinensis and A. deliciosa, as well as in some close relatives. Mitochondrial intraspecific polymorphism was detected in five species, i.e., A. arguta (B + D), A. callosa (D + G), A. deliciosa (D + G + H), A. eriantha (D + G), and A. melanandra (B + D). Mitotype B is present in A. arguta and A. melanandra but absent from the two plants selected to represent those taxa on the chloroplast phylogenetic trees. There are mitotypes present in diploids only (A, E, F, G), in tetraploids only (B), or in hexaploids only (H). There are also two cases in which diploid, tetraploid, and hexaploid taxa shared the same mitotype (D, G).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Paternal phylogeny and systematic implications
The monophyly of the genus Actinidia demonstrated using rbcL and trnL-trnF sequences and one member of each of the two other genera of the Actinidiaceae as outgroups is well supported by the decay index (4), the number of synapomorphies (11), and the bootstrap value (85%). In contrast, the sections as currently defined using morphological traits (Cui et al., 2002 ) are not monophyletic, confirming the findings of Li et al. (2002) based on nuclear ITS sequences. This is clear in the case of Stellatae and Maculatae, but also in that of the under- represented section Strigosae, with two members falling in each of the two major clades I and II. Even members of the morphologically distinct section Leiocarpae (Huang et al., 1999 ; He et al., 2000 ) do not form a natural group. As already suggested (Testolin et al., 1997 ; Li et al., 2002 ), A. rufa, formerly placed in the same section as A. melanandra and A. polygama by Dunn (1911) , should better be excluded from the section Leiocarpae on the basis of the information provided by nuclear (Huang et al., 1997 ; Testolin and Ferguson, 1997 ), chloroplast (Huang et al., 1997 ; Cipriani et al., 1998 ), and mitochondrial (present study) genomes. Even if this particular taxon is omitted, the section Leiocarpae remains paraphyletic in each of the four equally parsimonious chloroplast trees. However, support for the nodes that portray a paraphyletic Leiocarpae is weak, and trees supporting a monophyletic Leiocarpae are only three steps longer than the most parsimonious chloroplast trees.

Finally, cpDNA phylogeny is inconsistent with the current classification of Cui et al. (2002) . The major clades of the cpDNA trees received no support from the morphological characteristics traditionally considered for the classification of Actinidia. From previous morphological studies (He et al., 2000 ; Huang et al., 2002 ), it was apparent that the delimitation of most if not all the four sections are based on homoplasious morphological character states. Spotted fruit and lamellate pith that characterize the section Maculatae and the series Lamellatae of the section Leiocarpae, respectively, are also shared by some members of the other sections (Cui et al., 2002 ).

Maternal phylogeny and systematic implications
This study represents the first use of molecular markers of mitochondrial origin to characterize genetic diversity in Actinidia. A first conclusion is the occurrence of mtDNA diversity within Actinidia. Both mitochondrial regions chosen for this study displayed variation among and sometimes within Actinidia species. However, the only informative characters that were revealed were indels. Present in the two outgroups as well as spread over the four Actinidia sections, mitotype D appears to be ancestral. Consequently, neither the monophyly of Actinidia nor that of the sections can be assessed for the mitochondrial genome. At the series level, and by contrast with the chloroplast data, the mitochondrial data support unambiguously the hypothesis of a close relationship between the three Solidae species based on the sharing of mitotype C by A. macrosperma, A. polygama, and A. valvata.

Six derived mitotypes differ from the ancestral one by deletions or insertions, possibly due to duplication of DNA motifs. The detection of several motifs, each repeated two or three times within nad1-2/3, confirms the first report of microsatellite polymorphisms in plant mitochondria by Soranzo et al. (1999) . Unfortunately, the molecular variation detected in the nad1-2/3 sequences is particularly difficult to interpret in terms of character polarization for the phylogenetic reconstructions. Likewise, additional phylogenetic-informative substitutions that could have been of great help for reconstruction are absent from our mitochondrial sequences. Clearly, one five-state character (nad1-2/3) and three binary characters (nad4-1/2) are far too few to properly resolve the maternal phylogeny of 30 Actinidia species. Additional molecular data are needed to provide more resolution.

Congruences between maternal and paternal phylogenies
Even if they provide little resolution on their own, mapping the mitotypes onto the paternal chloroplast-based phylogeny clarifies part of the phylogenetic history of the Actinidia species. In several cases indeed, the relationships deduced from the mitochondrial characters do not conflict with those revealed in the chloroplast-based parsimony analysis, as the plants sharing the same derived mitotypes are also closely related in the paternal tree. Two mitotypes are shared by sister taxa on the cpDNA tree (B by A. arguta and A. melanandra, C by A. valvata and A. polygama and by var. mumoides and var. macrosperma of A. macrosperma), and mitotype G is shared by most members of the large polytomy that includes the cultivated species. This result is not so trivial, because many Actinidia species can be crossed under experimental conditions (Hirsch et al., 2001 ), suggesting that interspecific hybridization could have played a major role in the evolutionary history of the genus.

Incongruences between maternal and paternal phylogenies
Despite this overall pattern, our data also provide evidence for striking incongruences between maternal and paternal phylogenies: (1) the sharing of identical mitotypes by taxa distantly related on the cpDNA trees and (2) the occurrence of distinct mitotypes in taxa closely related on the cpDNA trees.

A first group of incongruences involves mitotype G, with its unexpected presence in A. rufa and A. lijiangensis, and the presence of mitotype D instead of the expected mitotype G in one accession of A. deliciosa. The presence of mitotype G in A. lijiangensis could result from homoploid hybrid speciation or from introgression. Unfortunately, this species was not included in the phylogenetic study conducted by Li et al. (2002) using sequences of internal transcribed spacer (ITS) of nuclear ribosomal DNA, so its putative hybrid origin cannot be confirmed. The apparent conflicts for the other two species, i.e., A. rufa and A. deliciosa, could be due to ancestral polymorphism, resulting in incomplete lineage sorting in the case of A. deliciosa. The absence or the low levels of intraspecific polymorphism displayed by the ITS nuclear sequences of A. chinensis, A. deliciosa, and A. rufa (Li et al., 2002 ) suggest that these three species are not of hybrid origin, therefore supporting the hypothesis of an ancestral polymorphism. Furthermore, A. rufa belongs to a clade that emerges as sister to the largely unresolved group including A. chinensis and A. deliciosa in the cpDNA tree. However, to attribute the presence of mitotype D and G within A. deliciosa to incomplete lineage sorting requires that A. deliciosa inherited that polymorphism from its progenitors. The view supported by Testolin and Ferguson (1997) on the basis of isozyme evidence is that A. deliciosa has originated from the sole A. chinensis by autopolyploidy. The nuclear ITS trees (Li et al., 2002 ) appears, too, to favor this hypothesis. However, mitotype D has been found neither in the diploid cytotypes nor in the tetraploid cytotypes of A. chinensis sampled in the present study. If the absence of mitotype D in A. chinensis is confirmed, the unique mitotype D found in A. deliciosa would likely originate from a hybridization/introgression event involving one particular plant or population. More intensive sampling from A. chinensis, particularly outside the geographical area previously prospected, coupled with sequencing of the nuclear ITS DNA of that particular plant will provide additional insights into the relationship between A. chinensis and A. deliciosa.

A second group of incongruences concerns mitotype C. Actinidia macrosperma shares mitotype C with A. polygama and A. valvata although they appear to be distantly related in the cpDNA trees. Contrary to chloroplast data, mitochondrial data support unambiguously the monophyly of the series Solidae characterized morphologically by nonspotted fruits and solid pith. The comparison of chloroplast and mitochondrial data sets suggests that both varieties of A. macrosperma are actually the result of hybridization/introgression events, which is consistent with previous suggestions by Li et al. (2002) . Both mtDNA mitotypes (present data) and nuclear ITS trees (Li et al., 2002 ) support a close relation between A. macrosperma and A. valvata, whereas the cpDNA trees portray the two varieties of A. macrosperma as the remnants of a basal chloroplast lineage within Actinidia. Li et al. (2002) speculated that a recent introgression of A. callosa var. strigillosa into A. macrosperma might have occurred, but neither cpDNA nor mtDNA data support this. In light of all the molecular data, a hybrid origin (allotetraploid) of the two varieties of A. macrosperma appears likely, although the exact parentage and the timing of the hybridizations cannot be clearly established. The hybrid origin of A. macrosperma could obscure the circumscription of the series Solidae in terms of morphological character.

Intraspecific polymorphism as an indicator of reticulation events
Five of the eight species that were represented by at least two taxa in our sampling, i.e., A. callosa, A. cylindrica, A. deliciosa, A. eriantha, and A. glaucophylla, were polyphyletic in their cpDNA (A. cylindrica and A. glaucophylla) or in their mtDNA (A. deliciosa, the particular case of A. deliciosa having been discussed previously, it will not be treated in this paragraph) or in both their cpDNA and mtDNA (A. callosa and A. eriantha).

The tetraploid A. cylindrica var. reticulata (clade I in the chloroplast-based tree) appears to be distantly related to the conspecific diploid var. cylindrica (clade II) but closely related to A. eriantha, strongly suggesting that it is an allopolyploid arising through hybridization with a male parent similar to the present-day diploids of A. eriantha. Similarly, one of the two varieties of A. glaucophylla may also be derived from hybridization, although this is not so clear due to less divergent chloroplast sequences.

Actinidia callosa var. strigillosa differs from the other two diploid varieties, henryi and discolor, by at least 11 chloroplast substitutions and by its mitotype. In addition, the tetraploid var. strigillosa combines two types of ITS nuclear sequences, one "chinensis-like" and one "callosa-like," a feature that contrasts with the low divergence observed between the other two diploid varieties (Li et al., 2002 ). Comparison of data from biparentally inherited ITS nuclear DNA and paternally inherited cpDNA allowed Li et al. (2002) to identify putative maternal (diploid varieties of A. callosa) and paternal (A. chinensis or A. deliciosa) parents. The present study reveals that var. strigillosa possesses not only the cpDNA of its pollen donor but also its mtDNA. This surprising finding can be accounted for by a complex evolutionary scenario involving more than one hybridization event (Fig. 4). This scenario includes the two steps of the so-called "multiple origin of polyploids" scenario previously described by Soltis and Soltis (1999) , i.e., recurrent polyploidization and subsequent interbreeding. It ultimately generates genotypes that continue to show additive ITS nuclear DNA pattern but may exhibit both cpDNA and mtDNA types of a single parent, A. chinensis in the case of A. callosa var. strigillosa. This scenario does make sense given the relatively high level of interfertility encountered in hybridizations involving A. callosa and A. chinensis under experimental conditions (Hirsch et al., 2001 ) and the overlap in the geographic distribution of the two species (Liang, 1983 ). Moreover, an introgression of A. chinensis into A. callosa var. strigillosa is considered as plausible by Li et al. (2002) , based on the shared presence of morphological character states such as the presence of numerous conspicuous trichomes on leaves and sepals. The same pattern is apparent for A. eriantha var. brunea, which combines both distantly related chloroplast sequences and distinct mitotypes compared to the other three conspecific taxa, namely var. alba, calvescens, and eriantha. A scenario involving more than one hybridization event and resembling that depicted for A. callosa var. strigillosa in Fig. 4 is likely for A. eriantha var. brunea.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 4. Probable origin of A. callosa var. strigillosa based on the phylogenetic information provided by chloroplast (cp, paternally inherited), mitochondrial (mt, maternally inherited) and nuclear (nc, biparentally inherited) genomes. This scenario corroborates the revised view of polyploid formation in plants that has been extensively documented during the past several years (e.g., Doyle et al., 1990 ; Soltis and Soltis, 1993 )

 
Relationships between A. setosa, A. chinensis, and A. deliciosa
The island species A. setosa, endemic of Taiwan, was first considered by Li (1952) to be conspecific with the mainland A. chinensis found in China. Actinidia setosa has been rarely included in the morphological and molecular studies and its phylogenetic relationships with A. chinensis and A. deliciosa remain unclear. Liang and Ferguson (1985) support its recognition as a separate species. Here, we found that individuals attributed to this species have diverged from A. chinensis and A. deliciosa at both cpDNA and mtDNA genomes. In contrast, A. chinensis and A. deliciosa have been previously considered to belong to a species complex (Testolin et al., 1997 ; Cipriani et al., 1998 ). Since then, evidence in this direction has accumulated. As shown by artificial hybridizations, fertility between A. chinensis diploids and A. chinensis tetraploids (Guijun et al., 1994 ), as well as between A. chinensis tetraploids and A. deliciosa hexaploids (Hirsch et al., 2001 ), is reduced but sufficient to maintain current gene flow between all three cytotypes. Likewise, because there are large zones of contact between A. chinensis and A. deliciosa (Ferguson, 1990 ), gene exchanges are expected to occur in nature, too. The existence of transitional forms in the areas where the two species overlap suggests that hybridization occurs (Ferguson, 1990 ). In line with this finding, A. chinensis and A. deliciosa show similar, if not identical, sequences (present study and Li et al., 2002 ) and appear closely related in all the resulting molecular phylogenies. Recent divergence and high levels of species interfertility thus provide considerable support for such a species complex hypothesis.

In conclusion, chloroplast phylogenetic information provides clear evidence of conflicts with morphological classifications. This suggests that the infrageneric classifications that have been erected in the past do not reflect the molecular evolutionary history of the Actinidia species, at least with respect to the chloroplast genome. However, it is not possible to generalize this conclusion to the mitochondrial genome because of the poor phylogenetic signal in the corresponding data. Based on the nuclear, chloroplast, and mitochondrial molecular data currently available in Actinidia and summarized in Table 4, we estimate that more than one-quarter of the living taxa (12 of the 41 taxa examined) has experienced at least one episode of hybridization at some point in their evolutionary history. Moreover, some reticulation events may have been missed due to the incomplete ITS nuclear data set together with the lack of molecular resolution, particularly with respect to the mitochondrial data. Thus, the rate of hybridization is certainly underestimated. It is probable that the relatively high level of species interfertility, leading to allopolyploid but probably also to homoploid hybridization, accounts for the taxonomic confusion presently recognized within the genus.


View this table:
[in this window]
[in a new window]
 
Table 4. Evidence of reticulate evolution among Actinidia species. Information summarized from the present study and from that of Li et al. (2002) (cp, chloroplast; mt, mitochondrial; NA, data not available)

 


    FOOTNOTES
 
1 The authors thank Anne-Marie Hirsch, Jocelyne Chartier, Hongwen Huang, Raffaele Testolin for providing material for the molecular work; Pierre-Yves Dumoulin for field assistance; Cecile Aupic for advice concerning vouchers; and Vincent Savolainen for helpful discussion. This study was part of a European project in cooperation with China (INCO-DC IC18-CT97-0183). Back

5 Present address: UMR ECOBIOP, INRA Hydrobiologie, F-64310 Saint Pée sur Nivelle, France. E-mail: chat{at}st-pee.inra.fr Back


    LITERATURE CITED
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Anderberg A. A. C. Rydin M. Källersjö 2002 Phylogenetic relationships in the order Ericales s.l.: analyses of molecular data from five genes from the plastid and mitochondrial genomes. American Journal of Botany 89: 677-687[Abstract/Free Full Text]

Bakker F. T. A. Culham C. E. Pankhurst M. Gibby 2000 Mitochondrial and chloroplast DNA-based phylogeny of Pelargonium (Geraniaceae). American Journal of Botany 87: 727-734[Abstract/Free Full Text]

Bowe L. M. G. Coat C. W. dePamphilis 2000 Phylogeny of seed plants based on all three genomic compartments: extant gymnosperms are monophyletic and Gnetales' closest relatives are conifers. Proceedings of the National Academy of Sciences of the United States of America 97: 4092-4097[Abstract/Free Full Text]

Bremer K. 1994 Branch support and tree stability. Cladistics 10: 295-304[CrossRef][Web of Science]

Chat J. L. Chalak R. J. Petit 1999 Strict paternal inheritance of chloroplast DNA and maternal inheritance of mitochondrial DNA in intraspecific crosses of kiwifruit. Theoretical & Applied Genetics 99: 314-322[CrossRef]

Chaw S.-M. C. L. Parkinson Y. Cheng T. M. Vincent J. D. Palmer 2000 Seed plant phylogeny inferred from all three plant genomes: monophyly of extant gymnosperms and origin of Gnetales from conifers. Proceedings of the National Academy of Sciences of the United States of America 97: 4086-4091[Abstract/Free Full Text]

Cho Y. Y.-L. Qiu P. Kuhlman J. D. Palmer 1998 Explosive invasion of plant mitochondria by a group I intron. Proceedings of the National Academy of Sciences of the United States of America 95: 14244-14249[Abstract/Free Full Text]

Cipriani G. R. Testolin R. Gardner 1998 Restriction-site variation of PCR-amplified chloroplast DNA regions and its implication for the evolution and taxonomy of Actinidia. Theoretical & Applied Genetics 96: 389-396[CrossRef]

Cipriani G. R. Testolin M. Morgante 1995 Paternal inheritance of plastids in interspecific hybrids of the genus Actinidia revealed by PCR-amplification of chloroplast DNA fragments. Molecular & General Genetics 247: 693-697

Cronquist A. 1981 An integrated system of classification of flowering plants. Columbia University Press, New York, New York, USA

Cui Z. H. Huang X. Xingguo 2002 Actinidia in China. China Agricultural Science and Technology Press, Beijing, People's Republic of China

Demesure B. N. Sodzi R. J. Petit 1995 A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Molecular Ecology 4: 129-131[Medline]

Dickison W. C. 1972 Observations on the floral morphology of some species of Saurauia, Actinidia, and Clematoclethra. Journal of the Elisha Mitchell Scientific Society 88: 43-54

Dickison W. C. J. W. Nowicke J. J. Skvarla 1982 Pollen morphology of the Dilleniaceae and Actinidiaceae. American Journal of Botany 69: 1055-1073[CrossRef][Web of Science]

Doyle J. J. J. L. Doyle A. H. D. Brown J. P. Grace 1990 Multiple origins of polyploids in the Glycine tabacina complex inferred from chloroplast DNA polymorphism. Proceedings of the National Academy of Sciences of the United States of America 87: 714-717[Abstract/Free Full Text]

Doyle J. J. M. Morgante S. V. Tingey W. Powell 1998 Size homoplasy in chloroplast microsatellites of wild relatives of soybean (Glycine Subgenus Glycine). Molecular Biology and Evolution 15: 215-218[Web of Science][Medline]

Dumolin-Lapègue S. M. H. Pemonge R. J. Petit 1998 Association between chloroplast and mitochondrial lineages in oaks. Molecular Biology and Evolution 15: 1321-1331[Abstract]

Dunn S. T. 1911 A revision of the genus Actinidia, Lindl. Journal of the Linnean Society of London, Botany 39: 394-410

Eriksson T. 1999 Autodecay version 4.0. Bergius Foundation, Royal Swedish Academy of Sciences, Stockholm, Sweden

Farris J. S. 1969 A successive approximation approach to character weighting. Systematic Zoology 18: 374-385[CrossRef]

Farris J. S. M. Kallersjo A. G. Kluge C. Bult 1995 Testing significance of incongruence. Cladistics 10: 315-319[CrossRef][Web of Science]

Fauré S. J.-L. Noyer F. Carreel J.-P. Horry F. Bakry C. Lanaud 1994 Maternal inheritance of chloroplast genome and paternal inheritance of mitochondrial genome in bananas (Musa acuminata). Current Genetics 25: 265-269[CrossRef][Web of Science][Medline]

Felsenstein J. 1985 Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791[CrossRef][Web of Science]

Ferguson A. R. 1990 Botanical nomenclature: Actinidia chinensis, Actinidia deliciosa, and Actinidia setosa. In I. J. Warrington and G. C. Weston [eds.], Kiwifruit: science and management, 36–57. Ray Richards Publisher, Auckland, New Zealand

Freudenstein J. V. M. W. Chase 2001 Analysis of mitochondrial nad1b-c intron sequences in Orchidaceae: utility and coding of length- change characters. Systematic Botany 26: 643-657[Web of Science]

Guijun Y. A. R. Ferguson M. A. McNeilage 1994 Ploidy races in Actinidia chinensis. Euphytica 78: 175-183[CrossRef][Web of Science]

Havey M. J. J. D. McCreight B. Rhodes G. Taurick 1998 Differential transmission of the Cucumis organellar genomes. Theoretical & Applied Genetics 97: 122-128[CrossRef]

He Z. X. Zhang Y. Zhong L. Ye 2000 Phylogenetic relationships of Actinidia and related genera based on micromorphological characters of foliar trichomes. Genetic Resources and Crop Evolution 47: 627-639[CrossRef][Web of Science]

Hiesel R. A. von Haeseler A. Brennicke 1994 Plant mitochondrial nucleic acid sequences as a tool for phylogenetic analysis. Proceedings of the National Academy of Sciences of the United States of America 91: 634-638[Abstract/Free Full Text]

Hirsch A. M. R. Testolin S. Brown J. Chat F. D. Fortune J. M. Bureau D. De Nay 2001 Embryo rescue from interspecific crosses in the genus Actinidia (kiwifruit). Plant Cell Reports 20: 508-516[CrossRef][Web of Science]

Hopping M. E. 1994 Flow cytometric analysis of Actinidia species. New Zealand Journal of Botany 32: 85-93

Huang H. F. Dane Z. Wang Z. Jiang R. Huang S. Wang 1997 Isozyme inheritance and variation in Actinidia. Heredity 78: 328-336[CrossRef][Web of Science]

Huang H. J. Li P. Lang S. Wang 1999 Systematic relationships in Actinidia as revealed by cluster analysis of digitized morphological descriptors. Acta Horticulturae 498: 71-78

Huang H. L. Zuozhou L. Jianqiang 2002 Phylogenetic relationships in Actinidia as revealed by RAPD analysis. Journal of the American Society for Horticultural Science 127: 759-766[Web of Science]

Judd W. S. K. A. Kron 1993 Circumscription of Ericaceae (Ericales) as determined by preliminary cladistic analyses based on morphological, anatomical, and embryological features. Brittonia 45: 99-114

Kron K. A. M. W. Chase 1993 Systematics of the Ericaceae, Empetraceae, Epacridaceae and related taxa upon rbcL sequence data. Annals of the Missouri Botanical Garden 80: 735-741[CrossRef][Web of Science]

Li H.-L. 1952 A taxonomic review of the genus Actinidia. Journal of the Arnold Arboretum, Harvard University 33: 1-61

Li J. H. Huang T. Sang 2002 Molecular phylogeny and infrageneric classification of Actinidia (Actinidiaceae). Systematic Botany 27: 408-415[Web of Science]

Liang C. F. 1983 [On the distribution of Actinidias]. Guihaia 3: 229-248

Liang C. F. A. R. Ferguson 1986 The botanical nomenclature of the kiwifruit and related taxa. New Zealand Journal of Botany 24: 183-184

Liang C.-F. A. R. Ferguson 1985 [Revision of intraspecific taxa of Actinidia chinensis Planch]. Guihaia 5: 71-72

Lindley J. 1836 A natural system of botany. Longman, London, UK

McNeilage M. A. J. A. Considine 1989 Chromosome studies in some Actinidia taxa and implications for breeding. New Zealand Journal of Botany 27: 71-81[Web of Science]

Morton C. M. A. M. Scott T. P. Ghillean G. K. Ken M. W. Chase 1997 Phylogenetic relationships of Lecythidaceae: a cladistic analysis using rbcL sequences and morphological data. American Journal of Botany 84: 530-540[Abstract]

Neale D. B. R. R. Sederoff 1989 Paternal inheritance of chloroplast DNA and maternal inheritance of mitochondrial DNA in loblolly pine. Theoretical & Applied Genetics 77: 212-216

Olmstead R. G. J. D. Palmer 1994 Chloroplast DNA systematics: a review of methods and data analysis. American Journal of Botany 81: 1205-1224[CrossRef][Web of Science]

Ronfort J. P. Saumitou-Laprade J. Cuguen D. Couvet 1995 Mitochondrial DNA diversity and male sterility in natural populations of Daucus carota ssp. carota. Theoretical & Applied Genetics 91: 150-159

Schmid R. 1978 Reproductive anatomy of Actinidia chinensis (Actinidiaceae). Botanische Jahrbucher fur Systematik, Pflanzengeschichte und Pflanzengeographie 100: 149-195

Shi S. Q. Wang Z. Zhang 1994 New taxa of the genus Actinidia from Guizhou. Acta Botanica Yunnanica 16: 345-347

Simmons M. P. H. Ochoterena 2000 Gaps as characters in sequence- based phylogenetic analyses. Systematic Biology 49: 369-381[CrossRef][Web of Science][Medline]

Soltis D. E. P. S. Soltis 1993 Molecular data and the dynamic nature of polyploidy. Critical Reviews in Plant Sciences 12: 243-273

Soltis D. E. P. S. Soltis 1999 Polyploidy: recurrent formation and genome evolution. Trends in Ecology & Evolution 14: 348-352

Soranzo N. J. Provan W. Powell 1999 An example of microsatellite length variation in the mitochondrial genome of conifers. Genome 42: 158-161[Medline]

Swofford D. L. 1998 Phylogenetic analysis using parsimony, version 4. Sinauer, Sunderland, Massachusetts, USA

Taberlet P. T. L. Gielly G. Pautou J. Bouvet 1991 Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105-1109[CrossRef][Web of Science][Medline]

Takhtajan A. L. 1980 Outline of the classification of flowering plants (Magnoliophyta). Botanical Review 46: 225-359[Web of Science]

Testolin R. G. Cipriani 1997 Paternal inheritance of chloroplast DNA and maternal inheritance of mitochondrial DNA in the genus Actinidia. Theoretical and Applied Genetics 94: 897-903[CrossRef][Web of Science]

Testolin R. G. Cipriani A. R. Ferguson R. C. Gardner 1997 Molecular approaches to systematics of Actinidia. Acta Horticulturae (ISHS) 444: 97-102

Testolin R. A. R. Ferguson 1997 Isozyme polymorphism in the genus Actinidia and the origin of the kiwifruit genome. Systematic Botany 22: 685-700[CrossRef][Web of Science]

Thompson J. D. T. J. Gibson F. Plewniak F. Jeanmougin D. G. Higgins 1997 The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24: 4876-4882

Wang X.-Q. D. C. Tank T. Sang 2000 Phylogeny and divergence times in Pinaceae: evidence from three genomes. Molecular Biology and Evolution 17: 773-781[Abstract/Free Full Text]

Wendel J. F. 2000 Genome evolution in polyploids. Plant Molecular Biology 42: 225-249[CrossRef][Web of Science][Medline]

Wheeler W. C. J. Gatesy R. DeSalle 1995 Elision: a method for accomodating multiple molecular sequence alignments with alignment- ambiguous sites. Molecular Phylogenetics and Evolution 4: 1-9[CrossRef][Medline]

Yan G. J. Yao A. R. Ferguson M. A. McNeilage A. G. Seal B. G. Murray 1997 New reports of chromosome numbers in Actinidia (Actinidiaceae). New Zealand Journal of Botany 35: 181-186[Web of Science]

Young N. D. J. Healy 2003 GapCoder automates the use of indel characters in phylogenetic analysis. Bmc Bioinformatics 4: 6[CrossRef][Medline]

Zhang J. E. J. Beuzenberg 1983 Chromosome numbers in two varieties of Actinidia chinensis Planch. New Zealand Journal of Botany 21: 353-355[Web of Science]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Am. J. Bot.Home page
J. Shaw and R. L. Small
Chloroplast DNA phylogeny and phylogeography of the North American plums (Prunus subgenus Prunus section Prunocerasus, Rosaceae)
Am. J. Botany, December 1, 2005; 92(12): 2011 - 2030.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chat, J.
Right arrow Articles by Nadot, S.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Chat, J.
Right arrow Articles by Nadot, S.
Agricola
Right arrow Articles by Chat, J.
Right arrow Articles by Nadot, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS