| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Systematics |
Department of Integrative Biology and University Herbarium, and Jepson Herbarium, University of California, Berkeley, California 94720 USA
Received for publication June 3, 2003. Accepted for publication September 11, 2003.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Key Words: adaptive radiation • Andes • biogeography • Eriosorus • ETS • Jamesonia • Neotropics • páramo • pteridophytes
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
; Baldwin et al., 1991
; Baldwin, 1997
, 1998
) and the lobelioids (Givnish, 1995
; Givnish et al., 1996
) in the Hawaiian Islands are well-documented. However, no cases in ferns have been reported so far. Young ecosystems provide an excellent opportunity for radiations to occur. In the Neotropics, some angiosperm groups such as Espeletia and Senecio and lycopod groups such as Huperzia have undergone presumably recent radiations and adapted to extreme conditions in the young alpine ecosystems known as páramos (Cuatrecasas, 1986
; Van der Hammen, 1988
, 1989
; Monasterio and Sarmiento, 1991
; Ahti, 1992
; Wikström et al., 1999
; Rausher, 2002
). The term páramo generally refers to the Andean highlands, between 3200 and 5000 m, above the tree line but below the permanent snow line (Van der Hammen and Cleef, 1986
; Luteyn, 1999
). Páramos are characterized by strong winds, high levels of insolation, high moisture in the soil, high atmospheric moisture, and cool temperatures ranging from –2°C to 12°C. There are diurnal fluctuations in temperatures with freezing during the night (Sarmiento, 1986
; Luteyn, 1991
, 1999
). The present environmental conditions in the páramo appeared with the last major uplifting of the northern Andes during the Pliocene, 3–5 million years ago (Hooghiemstra, 1984
; Van der Hammen and Cleef, 1986
; Van der Hammen, 1988
, 1989
, 1995
).
Jamesonia is a neotropical páramo genus and occurs in cool wet highlands, ranging from 1500 to 5000 m. The geographical distribution of this genus is from southern Mexico to central Bolivia and southern Brazil, with most species found in the Andes. Twenty species have been recognized in the genus (Tryon, 1962
). This highly modified group of ferns has a suite of morphological features perhaps related to the extreme environmental conditions prevailing in páramo ecosystems. Some of the most outstanding morphological features of this genus include indeterminate growth leaf, xeromorphic, coriaceous leaves, and extremely reduced pinnae (herein called the jamesonia morphotype). These structural variations are hypothesized to represent evolutionary trends that were favored by the extreme environmental conditions prevailing in páramo ecosystems.
Eriosorus is mostly neotropical. Eriosorus is mainly found in cool and moist highlands such as cloud forests and sub-páramos, and 25 species have been recognized (Tryon, 1970
). Eriosorus is restricted primarily to the Andes, although its geographical distribution extends from Mexico and the West Indies south to Bolivia, Brazil, Uruguay, as well as the Tristan da Cunha and Gough Islands in the south Atlantic Ocean. More than half of the taxa occur above 2200 m, and only three are found below 1800 m. Andean fossil records indicate that spores of Eriosorus first appeared during the Oligocene (Van der Hammen and Gonzáles, 1960
). This group exhibits a wide variety of frond morphologies that range from tripinnate to pinnate, representing the transitional changes that are hypothesized to have resulted in the jamesonia morphotype (Tryon, 1970
).
Taxonomy and hypotheses of close relatives
Jamesonia was first described with one species, Jamesonia pulchra, by Hooker and Greville in 1830 (Tryon, 1962
). Historically, Eriosorus has been regarded as Jamesonia's closest relative. Eriosorus was proposed by Fée (1852)
, and on the basis of sori similarity, it was included with Jamesonia and five other genera under Polypodiaceae, subtribe Cheilantheace in the group Eucheilantheae. In the same work, Eriosorus rufescens (as Gymnogramma) was included in the subtribe Hemionitideae, group Leptogrammeae, which also included Pterozonium Kunh. While Kunze (1846)
combined Gymnogramma under Jamesonia addressing morphological similarities of the genera, Kunh (1882)
grouped Jamesonia and Eriosorus under the name Psilogramme. In 1947, Copeland adopted the earlier name Eriosorus, which has been used since. Based on Christensen's classification (1938)
, Eriosorus was placed in the subfamily Gymnogrammeoideae, which also included Jamesonia, Pterozonium, and other three genera. Christensen (1938)
classified Jamesonia with Gymnogramma and Pterozonium in the tribe Gymnogrammeae of the Polypodiaceae. Holttum (1946)
treated Jamesonia in the Adianteaceae following Bower's classification. Copeland (1947)
placed Jamesonia, Pterozonium, and Eriosorus in the Pteridaceae where they are currently classified.
In 1970, Tryon hypothesized that "there is a close relationship between Eriosorus and Jamesonia and that Jamesonia is derived from more than one element in Eriosorus." Tryon also recognized Pterozonium, another neotropical genus, as a close relative of both Jamesonia and Eriosorus on the basis of sporangial disposition, venation patterns, indument, and spores (Tryon, 1962
, 1970
). According to the most recent taxonomic review (Tryon and Tryon, 1982
; Tryon et al., 1990
), Jamesonia, Eriosorus, and Pterozonium belong to subfamily Taenitidoideae (Pteridaceae) along with 10 other genera. A close relationship among these three genera has been strongly supported by phylogenetic analyses based on both morphological and molecular data (Sánchez-Baracaldo, 2000
).
Understanding the evolutionary history and biogeography of the Jamesonia-Eriosorus complex will help elucidate the origin and diversification of páramo flora, as well as mechanisms of diversification in ferns. Jamesonia is a potential example of a recent adaptive radiation because the group is characterized as being morphologically and ecologically diverse and its habitat is of recent origin. The general aim of this study was to understand the origin and diversification of Jamesonia using rigorous phylogenetic methods. More specifically, this paper aimed to determine the phylogenetic relationships of Jamesonia and Eriosorus and to test for their monophyly, as well as to document the biogeographic patterns of the group in the Neotropics.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
), 13 currently recognized species of Eriosorus (Tryon, 1970
), and one undescribed species of Eriosorus. Specimens were chosen to represent a wide variety of morphologies, habitats, and geographic origins, contingent on sample availability in the field and in herbaria. Samples were collected by the author from 40 localities across Costa Rica, Venezuela, Colombia, Ecuador, and Peru. In addition, samples were obtained from a further 29 localities across the same geographical range just mentioned, but also including Bolivia and Brazil. Two species of the neotropical genus Pterozonium were used as outgroups, one specimen of Pterozonium cyclosorum and two specimens of P. reniforme. Outgroup choice was based on a broader-scale phylogenetic hypothesis of the subfamily Taenitidoideae (Sánchez-Baracaldo, 2000
). Voucher specimens and locality information are listed in the Appendix (see Supplemental Data accompanying the online version of this article).
DNA extraction, amplification, and sequencing
Total genomic DNA was isolated from 30–100 mg of dry leaf material, using DNeasy Plant Mini Kits (Qiagen, Chatsworth, California, USA) following the manufacturer's protocol. Plastid-encoded rps4 plus the intergenic spacer rps4-trnS and nuclear rDNA ETS amplicons were generated by the polymerase chain reaction (PCR). The PCR reaction mixtures and PCR cycles differed depending on the genetic target. All reactions were performed in a Perkin Elmer (California, USA) GeneAmp PCR System 9600 thermocycler.
Chloroplast gene
Forward primer rps5 and reverse primer trnS (Souza-Chies et al., 1997
) were used to amplify the rps4 amplicon. PCR reaction mixtures (50 µL) contained 0.25 units of AmpliTaq Gold polymerase (PE Applied Biosystems, Foster City, California, USA), 5 µL of the supplied Buffer II (2.5 mmol/L MgCl2), 0.1 mmol/L of each dNTP, 2.5 mmol/L of each primer, 
50 ng of total genomic DNA, and purified water to volume. The PCR cycles were programmed as follows: an initial hot start of 95°C for 10 min, 35–40 cycles (94°C for 30 s, 58°C for 45 s, and 72°C for 90 s) and a 7-min final extension step at 72°C.
Nuclear gene
Sequencing of the ETS required the amplification of the whole intergenic spacer (IGS = NTS + ETS) between the 18S–26S rDNA repeat units (Fig. 1). The IGS region is often more than 4 kb in angiosperms (Baldwin and Markos, 1998
) and approximately 5 kb in members of the genera studied here.
|
100 ng of total genomic DNA, and purified water to volume. The IGS PCR products were first sequenced from the 3' region (18S fragment) into the ETS for eight different taxa representing extreme morphologies across the study group and geographical range. After 700 base pairs (bp), the internal primer ETS1 (5' GACGGTCGCTAAAACAAAGGGTC 3') was designed then used to sequence further into the ETS (Fig. 1). At about 1200 bp into the ETS, a second internal primer was designed, PETS1 (5' CTTGCGACGTCGGTAAGCAATC 3') in a region that appears to be conserved for the genera Jamesonia, Eriosorus, and Pterozonium. The PCR cycles for long fragments were programmed as follows: an initial hot start of 95°C for 10 min, 50 cycles (94°C for 45 s, 55°C for 45 s, and 72°C for 4 min with a 4-s increase per cycle) and a 7-min final extension step at 72°C.
The primers PETS and SSU120r were used for short-distance PCR (Fig. 1). The PCR reaction mixtures (50 µL) contained 0.25 units of AmpliTaq Gold polymerase (PE Applied Biosystems), 5 µL of the supplied Buffer II (2.5 mmol/L MgCl2), 0.1 mmol/L of each dNTP, 2.5 mmol/L of each primer, 50 ng of total genomic DNA, and purified water to volume. The PCR cycles were programmed as follows: an initial hot start of 95°C for 10 min, 50 cycles (94°C for 45 s, 61°C for 45 s, and 72°C for 90 s), and a 7-min final extension step at 72°C.
All PCR products were visualized with ethidium bromide on 1% agarose gels. Amplicons were purified with the QIAquick PCR purification kit (Qiagen) and then processed by cycle sequencing and BigDye-terminator chemistry (PE Applied Biosystems) on an ABI model 377 automated fluorescent sequencer in the Molecular Phylogenetics Laboratory at UC Berkeley.
Alignment and phylogenetic analysis
Sequence files were manipulated and mutations or changes were verified using the program Sequence Navigator (PE Applied Biosystems). Sequences were aligned visually with insertion of gaps where necessary using PAUP 4.0b10 (PPC; Swofford, 1999
). For rps4, a total of 993 bp were sequenced, 580 bp from the coding region and 413 bp from the intergenic spacer rps4-trnS. Twelve distinct shared insertion/deletion regions were recognized in the final alignment, and each was coded as a single binary character for the phylogenetic analyses. The intergenic spacer rps4-trnS was excluded for E. myriophyllus, P. cyclosorum, and P. reniforme because of ambiguity in the alignment. For ETS, a total of 1152 bp were sequenced. Eighteen distinct insertion/deletion regions were recognized in the final alignment and were each coded as a single binary character for phylogenetic analyses. Gaps were otherwise treated as missing data.
Pairwise genetic distances were calculated for each data set and maximum parsimony analyses were conducted using PAUP 4.0b10 (PPC; Swofford, 1999
). Then, taxa with uninformative characters were excluded to reduce search time for consequent analyses. For all analyses, the heuristic search algorithm option was used in a two-step process. The first step was to conduct 1000 searches using random addition starting trees with tree bisection-reconnection (TBR) swapping, but saving only one tree from each search. The second step was to swap on all 1000 trees found in the initial step using TBR swapping with MULPARS. Due to the large number of trees found, decay indices (Bremer, 1988
) were computationally prohibitive. Instead, bootstrap analyses (Felsenstein, 1985
) were used as a measure of support for the cladistic analyses performed. Bootstrapping of all data analyses used 100 replicates, with 10 random addition starting trees implemented for each replicate, TBR branch swapping, and MULPARS.
Three analyses were carried out in this study: (1) chloroplast phylogeny, rps4 and the intergenic spacer rps4-trnS alone; (2) nuclear phylogeny, ETS alone; and (3) total evidence, combined rps4 plus the intergenic spacer rps4-trnS and ETS. Only taxa that had sequences for both genes were included in the third analysis. To calculate genetic distances, both data sets rps4 and ETS (with a total of 2175 bp) were combined using the uncorrected ("p") distance to calculate genetic divergence.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
|
|
Clade I comprises E. rufescens, E. longipetiolatus, E. setulosus, E. congestus, E. hirtus, E. novogranatensis, J. goudotii, J. peruviana, J. cinnamomea, and J. verticalis (Figs. 2–4). Based on total evidence, there are two and perhaps three independent origins of the jamesonia morphotype within clade I (Fig. 4). The first is a monophyletic group, made up of J. goudotii and J. peruviana, nested within a paraphyletic group of E. rufescens, E. longipetiolatus, E. setulosus, E. congestus, E. hirtus, and E. novogranatensis. Jamesonia cinnamomea and J. verticalis represent a second origin of the jamesonia morphotype within clade I. There is not enough resolution in the chloroplast and nuclear topologies to resolve the phylogenetic relationships among the members of clade I (Figs. 2–4). The sequence divergence between the pairs of species within clade I range from 0.054 to 2%.
Clade II comprises E. flexuosus, E. lindigii, E. hispidulus, E. hirsutulus, E. cheilanthoides, and J. cuatrecasasii (Figs. 2– 4). The sequence divergence between the pairs of species within this clade range from 0.015 to 2.8%. The sister taxon of clades II and III is E. insignis from Brazil, based on total evidence (Fig. 4). In the nuclear phylogeny, E. insignis is sister to clade II (Fig. 3), but its position is unresolved in the chloroplast phylogeny (Fig. 2).
|
Eriosorus myriophyllus from Brazil is the sister of E. insignis plus the three Andean clades (Figs. 2–4). There is 14% sequence divergence between E. myriophyllus and the Andean radiations. In contrast, the Brazilian species E. insignis is on average only 2.7% divergent from the three main Andean clades. There was incongruence between the plastid and nuclear topologies in the placement of E. hirsutulus and E. sp. (239). For the plastid gene rps4, E. hirsutulus and E. sp. (239) are nested in clade II (Fig. 2). In contrast, in the analysis of the nuclear spacer ETS, E. hirsutulus and E. sp. (239) are nested in clade III (Fig. 3).
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
All analyses indicated that at least three separate radiations took place in the Andes (Figs. 2–4). In clade I, species are mostly restricted to the southern geographical range of the group, southern Colombia to Bolivia. Jamesonia cinnamomea and J. verticalis make up a monophyletic group based on rps4 (Fig. 2). Jamesonia cinnamomea is endemic to southern Colombia and northern Ecuador and is ecologically very specialized, being found at the highest elevational range reported for species with the jamesonia morphotype (Fig. 5). In contrast, J. verticalis has the lowest elevational range for species with the jamesonia morphotype. Jamesonia verticalis grows mostly in southern Colombia, northern Ecuador and in a few localities of Cordilleras Central and Occidental, Colombia (Fig. 5). Jamesonia goudotii is found from southern Colombia throughout Peru (Fig. 5), and J. peruviana is found throughout Peru and Bolivia. Eriosorus rufescens has a wide and scattered geographical distribution from Venezuela to Bolivia. The elevational range of E. rufescens is also broad with a clear trend toward reduction of pinnae with increased elevation (Fig. 5). Eriosorus hirtus and E. novogranatensis grow at lower elevations, always associated with vegetation along bank roads or along forest edges. Eriosorus congestus is endemic to Costa Rica and grows in forest understory. Eriosorus longipetiolatus and E. setulosus (Fig. 5) are geographically restricted to southern Colombia and northern Ecuador, where both are found at very high elevations. Considering all analyses, it is ambiguous whether there are two or three independent origins of the jamesonia morphotype in this clade (Figs. 2–4). The strict consensus in all analyses show a polytomy for clade I, and only a few subclades can be recognized, including some populations of J. goudotii and J. peruviana. Three alternative scenarios are possible in clade I: one, two, or three origins of the jamesonia morphotype.
|
Clade III has the highest level of morphological and ecological diversification within the Jamesonia lineages across all three clades, but at the same time has the lowest level of genetic divergence amongst its members. Most populations and species analyzed are endemic to Venezuela, Colombia, and Ecuador. The samples of J. alstonii, J. robusta, and J. laxa come from the Eastern Colombian Cordillera and Mérida, Venezuela. Jamesonia blepharum, J. imbricata, and J. scammanae are found throughout the whole geographical range of species with the jamesonia morphotype (Fig. 5). Jamesonia brasiliensis grows in Peru, Bolivia, and Brazil. In terms of morphological diversity, abundance, geographical distribution, and diversity of microhabitats, this group represents the most successful clade. Extremely low levels of sequence divergence are present among the three main subclades, in particular among the páramo lineages. Jamesonia alstonii, J. robusta, J. laxa, J. imbricata, J. brasiliensis, J. scammanae, and J. blepharum represent a great deal of morphological and ecological diversification (Fig. 5). However, at the molecular level, the average sequence divergence among these lineages is only 0.04%.
The molecular phylogenies in this study strongly support Tryon's interpretation of relationships that "there is a close relationship between Eriosorus and Jamesonia and that Jamesonia is derived from more than one element in Eriosorus" (Tryon, 1970
). In addition, Tryon (1962
, 1970)
reported the occurrence of hybrids among species of Eriosorus and species of Jamesonia, including hybrids across genera. In this study, the vouchers of E. hirsutulus (276) and E. sp. (239) showed no morphological evidence characteristic of hybrids on the basis of irregular spores and intermediate morphology of leaves. However, incongruence between plastid and nuclear topologies suggests a possible hybridization origin of both specimens. Further studies are needed to elucidate how hybridization could have played a role in the diversification of the Jamesonia-Eriosorus complex.
Low bootstrap values and low phylogenetic resolution, in the three separate analyses, suggest a case of recent and rapid diversification within the Jamesonia-Eriosorus complex. However, that which looks almost identical at the molecular level is very distinct at the morphological and ecological level. Disparity in ecological preferences seems to be characteristic of this complex across the three different clades and amongst closely related lineages. Low levels of molecular divergence result in a lack of phylogenetic resolution creating problematic issues in determining species delimitations. In this study, some traditionally delimited species with the jamesonia morphotype might be composed of populations that do not share a common ancestor (e.g., J. imbricata). Hence, current species names do not reflect the evolutionary history of some lineages with convergent morphologies.
The application of appropriate species concepts is extremely important when inferring evolutionary processes. Species should be defined by common ancestry in order to reflect their evolutionary history; otherwise, inferences about evolutionary processes could be misleading (Mishler and Donoghue, 1982
; Mishler and Theriot, 2000
). However, the lack of phylogenetic resolution becomes a problematic issue in cases of recent radiations. Examples of adaptive radiation tend to focus on recently and rapidly diversified groups, for which there is an apparent contradiction between morphological and molecular data. In such cases, morphologically distinct units are difficult to delimit based on molecular phylogenetic studies due to the lack of resolution. Moreover, distinct taxa should be recognized on the basis of other criteria such as morphological, cytological, and ecological data. Phylogenetic studies based on morphological data could help resolve species delimitation with careful exclusion of homoplastic characters.
Biogeographic patterns
Mapping geographic distributions onto a total-evidence phylogeny using MacClade 4.0 (Maddison and Maddison, 2000
) indicates that there are three main biogeographic areas of diversification: the Guayana Shield, the coastal region of Brazil, and the Andes (Fig. 6). Pterozonium species from the Guayana Shield are the sister group of the Jamesonia-Eriosorus complex from Brazil and the Andes. The Brazilian species, E. myriophyllus, is sister to the radiation in the Andes including the Brazilian species E. insignis. Numerous genera of plants and animals also share a disjunct distribution between the Andes and the coastal region of Brazil, Brazilian highlands (Rambo, 1951
; Lynch, 1979
; Brown, 1987
; Haffer, 1987
; Clark, 1992
; Safford, 1999
). For example, about one-third of the plant genera found in the Sierra do Itatiaia in Brazil are shared with the páramos of the Eastern Cordillera of Colombia (Safford, 1999
). Unfortunately, there are few phylogenetic studies of shared taxa between these two geographic regions addressing evolutionary history and biogeographic patterns (Brower, 1996
). More phylogenetic studies are needed to determine whether the distribution of these taxa should be attributed to vicariance or to dispersal events.
|
). The results of this study suggest that the northern Andes may have been the most influential biogeographic arena for the diversification of lineages within the Jamesonia complex. The northern Andes are the youngest, and most of their uplifting occurred in the last 5 million years (Van der Hammen, 1974
; Gentry, 1982
). The central Andes had a major uplift during the Oligocene (30 my BP) and emerged in their current form about 15 my BP between northern Chile and southern Peru, reaching their current structure by the Pliocene and Pleistocene (James, 1973
; Jordan et al., 1983
). Two well-supported clades can be recognized, roughly corresponding to the northern and central Andes, with an approximate distribution break at the volcanic area of southern Colombia and northern Ecuador (Fig. 6). A possible scenario is that two independent colonization events by Brazilian ancestors occurred and that this was followed by lineage diversification.
Clade I corresponds to the central Andes with most species found south of the volcanic area of Nariño (Colombia) and extending down into Bolivia (Fig. 6). Despite the fact that four OTUs (operational taxonomic units) in this clade came from Central America or the northern Andes, their current distribution might be explained by long-distance dispersal. Clades II and III correspond to the northern Andes. Eriosorus insignis appears to be the sister to clades II and III together (Fig. 6), supporting the hypothesis of two independent colonization events from Brazilian ancestors. Long-distance dispersal might also have played a role in the current distribution of some members of clades II and III (Fig. 6). Jamesonia brasiliensis (1122) from Sierra do Itatiaia in Brazil is nested within clade III, suggesting a long-distance dispersal event and supporting the pattern of shared flora between Eastern Cordillera of Colombia and Brazilian highlands (Safford, 1999
). Jamesonia bogotensis and J. canescens are well defined at the molecular level, and both are endemic to the Eastern Cordillera. There is little phylogenetic structure within clades II and III, with no correspondence to biogeography or phenotypic patterns, making it hard to determine how vicariance events in the three Colombian Cordilleras may have influenced speciation of these lineages. The extremely low genetic divergence between these taxa could be an indication that they underwent a recent redistribution during the last Pleistocene glaciations. High dispersability appears to be characteristic of certain lineages in clade III. Considering the recent origin of this clade and the genetic divergence of the most widespread species in clade III, its current geographical distribution could be attributed to the expansion of páramo environments during the Pleistocene (Van der Hammen and Cleef, 1986
).
Conclusions
Evidence from ETS and rps4 robustly rejects the monophyly of the two genera Jamesonia and Eriosorus. Both genera together form a monophyletic group; "jamesonia" is polyphyletic having arisen independently several times, making "eriosorus" paraphyletic. The "jamesonia" lineages have presumably undergone independent radiations in páramo habitats. All analyses indicated that three separate radiations took place in the Andes. The biogeographic patterns suggest that the Brazilian species, E. myriophyllus, is sister to the main Andean radiation including the Brazilian species E. insignis.
Additional molecular markers and morphological data may allow better phylogenetic resolution and a clearer scenario of the biogeographic history within this group. The combined study of phylogenetically independent Andean groups with similar geographical distributions will be essential in elucidating general patterns of speciation within the Andes.
|
FOOTNOTES |
|---|
2 Present address: School of Biological Sciences, University of Bristol, Woodland Road, Bristol, BS8 1UG, UK (p.sanchez-baracaldo{at}bristol.ac.uk
)
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Baldwin B. G. 1997 Adaptive radiation of the Hawaiian silversword alliance: congruence and conflict of phylogenetic evidence from molecular and non–molecular investigations. In T. J. Givnish and K. J. Sytsma [eds.], Molecular evolution and adaptive radiation, 103–128. Cambridge University Press, New York, New York, USA
Baldwin B. G. 1998 Molecular phylogenetic insights on the origin and evolution of oceanic island plants. In D. E. Soltis, P. S. Soltis, and J. J. Doyle [eds.], Molecular systematics of plants, II: DNA sequencing, 410–441. Kluwer Academic, Norwell, Massachusetts, USA
Baldwin B. G. D. W. Kyhos J. Dvorák G. D. Carr 1991 Chloroplast DNA evidence for a North American origin of the Hawaiian silversword alliance (Asteraceae). Proceedings of the National Academy of Sciences of the United States of America 88: 1840-1843
Baldwin B. G. S. Markos 1998 Phylogenetic utility of the external transcribed spacer (ETS) of 18S–26S rDNA: congruence of ETS and ITS trees of Calycadenia (Compositae). Molecular Phylogenetics and Evolution 10: 449-463[CrossRef][ISI][Medline]
Bremer K. 1988 The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42: 795-803[CrossRef][ISI]
Brower A. V. Z. 1996 Parallel race formation and the evolution of mimicry in Heliconius butterflies: a phylogenetic hypothesis from mitochondrial DNA sequences. Evolution 50: 195-221[CrossRef][ISI]
Brown K. S. 1987 Biogeography and evolution of neotropical butterflies. In T. C. Whitmore and G. T. Prance [eds.], Biogeography and Quaternary history in tropical America, Oxford monograrphs of biogeography, no. 3, 66–104. Clarendon Press, Oxford, UK
Carr G. D. D. W. Kyhos 1986 Adaptive radiation in the Hawaiian silversword alliance (Compositae-Mandiinae). II. Cytogenetics of artificial and natural hybrids. Evolution 40: 969-976
Christensen C. 1938 Filicinae. In Fr. Verdoorn [ed.], Manual of pteridology, 522–550. Martinus Nijhoff, The Hague, Netherlands
Clark L. G. 1992 Chusquea sect. Swallenochloa (Poaceae: Bambosoideae) and allies in Brazil. Brittonia 44: 387-422[CrossRef][ISI]
Copeland E. B. 1947 Genera Filicum. Chronica Botanica Company, Waltham, Massachusetts, USA
Cuatrecasas J. 1986 Speciation and radiation in the Espeletiinae in the Andes. In F. Vuilleumier and M. Monasterio [eds.], High altitude tropical biogeography, 267–303. Oxford University Press, New York, New York, USA
Fée M. A. 1852 Genera filicum, exposition des genres de la famille des Polypodiacées. Mémoire sur la famille des fougères. J. B. Baillière, Paris, France
Felsenstein J. 1985 Confidence limits of phylogenies: an approach using the bootstrap. Evolution 39: 783-791[CrossRef][ISI]
Gentry A. H. 1982 Neotropical floristic diversity: phytogeographical connections between Central and South America, Pleistocene climatic fluctuations, or an accident of the Andean orogeny?. Annals of the Missouri Botanical Garden 69: 557-593[CrossRef][ISI]
Givnish T. J. 1995 Molecular evolution, adaptive radiation, and geographic speciation in Cyanea (Campanulaceae, Lobelioideae). In W. L. Wagner and V. A. Funk [eds.], Hawaiian biogeography: evolution on a hot spot archipelago, 238–337. Smithsonian Institution Press, Washington, D.C., USA
Givnish T. J. E. Knox T. B. Patterson J. R. Hapeman J. D. Palmer K. J. Sytsma 1996 The Hawaiian lobelioids are monophyletic and underwent a rapid initial radiation roughly 15 million years ago. American Journal of Botany 83: 159.
Haffer J. 1987 Biogeography of neotropical birds. In T. C. Whitmore and G. T. Prance [eds.], Biogeography and Quaternary history in tropical America, Oxford Monographs of Biogeography, no. 3, 105–150. Clarendon Press, Oxford, UK
Holttum R. E. 1946 A revised classification of Leptosporangiate ferns. Botanical Journal of the Linnean Society 54: 123-158
Hooghiemstra H. 1984 Vegetational and climatic history of the high plain of Bogotá, Colombia: a continuous record of the last 3.5 million years. Dissertationes Botanicae 79: 1–368.
James D. E. 1973 The evolution of the Andes. Scientific American 229: 60-69[ISI]
Jordan T. E. B. L. Isacks R. W. Allmendiger J. A. Brewer V. A. Ramos C. J. Ando 1983 Andean tectonics related to geometry of subducted Nazca Plate. Bulletin of the Geological Society of America 94: 341-361.[Abstract]
Kunh M. 1882 Die Gruppe der Chaetopterides unter den Polypoiaceen. Festschrift zu dem fünfzigjährigen jubiläum der Königstädtischen Realschulezu Berlin, Chaetopterides 323–384. Winckelmann & Söhne, Berlin, Germany.
Kunze G. 1846 Farrnkräuter. Ernst Fleischer, Leipzig, Germany
Luteyn J. L. 1991 Páramos: Why study them?. In H. Balslev and J. L. Luteyn [eds.], Páramo an Andean ecosystem under human influence, 1–14. Academic Press, London, UK
Luteyn J. L. 1999 Páramos: a checklist of plant diversity, geographical distribution, and botanical literature. New York Botanical Garden Press, Bronx, New York, USA
Lynch J. D. 1979 The amphibians of the lowland tropical forest. In W. E. Duellman [ed.], The South American herpetofauna: its origin, evolution, and dispersal, 189–215. Museum of Natural History, Monograph no. 7. University of Kansas, Lawrence, Kansas, USA
Maddison D. R. W. P. Maddison 2000 MacClade 4: analysis of phylogeny and character evolution, vers. 4.0. Sinauer, Sunderland, Massachusetts, USA
Mishler B. D. M. J. Donoghue 1982 Species concepts: a case for pluralism. Systematic Zoology 31: 491-503[CrossRef]
Mishler B. D. E. C. Theriot 2000 The phylogenetic species concept (sensu Mishler and Theriot): monophyly, apomorphy, and phylogenetic species concepts. In Q. D. Wheeler and R. Meier [eds.], Species concept and phylogenetic theory, 44–54. Columbia University Press, New York, New York, USA
Monasterio M. L. Sarmiento 1991 Adaptive radiation of Espeletia in the cold Andean tropics. Trends in Ecology and Evolution 6: 387-391[CrossRef]
Rambo B. 1951 O elemento andino no pinhal riograndese. Anais Botânicos do Herbário Barbosa Rodriguez 3: 7-39
Rauscher J. T. 2002 Molecular phylogenetics of the Espeletia complex (Asteraceae): evidence from nrDNA ITS sequences on the closest relatives of and Andean adaptive radiation. American Journal of Botany 89: 1074-1084
Safford H. D. 1999 Brazilian Paramos II. Macro and mesoclimate of the campos de altitude and affinities with high mountain climates of the tropical Andes and Costa Rica. Journal of Biogeography 26: 713-737[CrossRef][ISI]
Sánchez-Baracaldo P. 2000 Phylogenetics and biogeography of an Andean fern radiation, the Jamesonia-Eriosorus complex. Ph.D. dissertation, University of California, Berkeley, California, USA
Sarmiento G. 1986 Ecological features of climates in high tropical mountains. In F. Vuilleumier and M. Monasterio [eds.], High altitude tropical biogeography, 11–45. Oxford University Press, New York, New York, USA
Souza-Chies T. T. G. Bittar S. Nadot L. Carter E. Besin B. Lejeune 1997 Phylogenetic analysis of Iridaceae with parsimony and distance methods using the plastid gene rps4. Plant Systematics and Evolution 204: 109-123[CrossRef][ISI]
Swofford D. L. 1999 PAUP*: phylogenetic analysis using parsimony, version 4.0 (* and other methods). Sinauer, Sunderland, Massachusetts, USA
Tryon A. 1962 A monograph of the fern genus Jamesonia. Contributions from the Gray Herbarium of Harvard University 1991: 109-203
Tryon A. 1970 A monograph of the fern genus Eriosorus. Contributions from the Gray Herbarium of Harvard University 200: 54-174
Tryon R. M. A. F. Tryon 1982 Fern and allied plants with special reference to tropical America. Springer-Verlag, New York, New York, USA
Tryon R. M. A. F. Tryon K. U. Kramer 1990 Pteridaceae. In K. Kubitzki [ed.], The families and genera of vascular plants: Pteridophytes and gymnosperms, 230–256. Springer–Verlag, Berlin, Germany
Van der Hammen T. 1974 The Pleistocene changes in vegetation and climate in tropical South America. Journal of Biogeography 1: 3-26
Van der Hammen T. 1988 South America. In B. Huntley and T. Webb [eds.], Vegetation history, 307–337. Kluwer, Dordrecht, Netherlands
Van der Hammen T. 1989 History of the mountain forest of the northern Andes. Plant Systematics and Evolution 162: 109-114
Van der Hammen T. 1995 El estudio del Plioceno y Cuaternario de la Sabana de Bogotá: Introducción histórica. In Van der Hammen [ed.], El Plioceno y Cuaternario del altiplano de Bogotá y alrededores, 13–32. Instituto Geográfico Augustin Codazzi, Bogotá, Colombia
Van der Hammen T. A. M. Cleef 1986 Development of the high Andean páramo flora and vegetation. In F. Vuilleumier and M. Monasterio [eds.], High altitude tropical biogeography, 153–201. Oxford University Press, New York, New York, USA
Van der Hammen T. E. González 1960 Upper Pleistocene and Holocene climate vegetation of the Sabana de Bogotá Colombia, South America. Leidse Geologische Mededelingen 25: 261-315
Wikström N. P. Kenrick M. Chase 1999 Epiphytism and terrestrialization in tropical Huperzia (Lycopodiaceae). Plant Systematics and Evolution 218: 221-243[CrossRef][ISI]
Windley B. F. 1984 The evolving continents. J. Wiley and Sons, Chichester, UK
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
