Am. J. Bot. Join the BSA
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via ISI Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, X.
Right arrow Articles by Vance Baird, Wm.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Liu, X.
Right arrow Articles by Vance Baird, Wm.
Agricola
Right arrow Articles by Liu, X.
Right arrow Articles by Vance Baird, Wm.
(American Journal of Botany. 2004;91:184-191.)
© 2004 Botanical Society of America, Inc.


Genetics and Molecular Biology

Identification of a novel gene, HAABRC5, from Helianthus annuus (Asteraceae) that is upregulated in response to drought, salinity, and abscisic acid1

Xianan Liu2,3 and Wm. Vance Baird2,4,5

2Horticulture Department and Genetics Graduate Program, Clemson University; 3Department of Plant Biology, 190 ERML, University of Illinois, Urbana, Illinois 61801 USA; 4Horticulture Department, Poole Agriculture Center, Box 340375, Clemson University, Clemson, South Carolina 29634-0375 USA

Received for publication May 22, 2003. Accepted for publication September 26, 2003.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 LITERATURE CITED
 
Using differential display of mRNA transcripts, we obtained a partial cDNA clone, RSC5-U, that is upregulated by exposure to high salinity. A longer cDNA of 812 nucleotides, designated HaABRC5, was then cloned by rapid amplification of cDNA ends. This full-length cDNA contains an open reading frame of 423 nucleotides encoding 141 amino acids, including a "bipartite nuclear targeting sequence." The deduced amino acid sequence had no similarity to known genes in the database. The expression of HaABRC5 was investigated in more detail using quantitative reverse transcriptase-polymerase chain reaction. HaABRC5 is upregulated by drought, high salinity, and exogenous application of abscisic acid (ABA). The promoter sequence of 229 nucleotides, upstream of HaABRC5, was cloned using rapid amplification of genomic ends. Three ABA-responsive elements were found within the HaABRC5 promoter region. Therefore, HaABRC5 is probably an ABA-responsive nuclear protein playing a role in plant stress response.

Key Words: abscisic acid • cDNA cloning • environmental stress • gene expression • gene regulation • promoter • sunflower


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 LITERATURE CITED
 
Cloning and characterization of environmental stress-induced genes has contributed greatly to our understanding of the physiological responses of plant cells at the molecular level to different environmental stresses. Some of the most important environmental stresses impacting plants are those that affect water status. For example, drought and/or salinity stress cause a number of physiological and biochemical changes in plants such as closure of stomata, decrease in photochemical activities, reduction of CO2 fixation, accumulation of osmolytes and osmoprotectants, and alteration in carbohydrate metabolism (reviewed by Tabaeizadeh, 1998 ). At the molecular level, many of these changes are the result of alterations in gene expression. Therefore, it is important to isolate and identify the genes that are regulated in response to water/salinity stress. Recently, a large number of drought-induced genes (Ingram and Bartels, 1996 ; Romo et al., 2001 ; Seki et al., 2001 ) and salinity-induced genes (Moons et al., 1997 ; Ramani and Apte, 1997 ; Bohnert et al., 2001 ; Kawasaki et al., 2001 ) have been cloned and characterized from different plant species. Among these stress-responsive genes, 40–50% of these code for unknown proteins (e.g., Rab-related proteins and dehydrins, Bohnert et al., 2001 ; Kawasaki et al., 2001 ). The identification of these unknown genes has not only led to the discovery of novel gene function, but also provides new information for a better understanding of the mechanism(s) involved in plant environmental stress response. The roles of these proteins in response to environmental stimuli will be better understood as more of these genes, their expression, and interaction are studied.

The plant phytohormone abscisic acid (ABA) is involved in osmotic stress response (i.e., drought and salinity) and has been shown to regulate the expression of various stress-responsive genes (Bray, 1993 ). Subsequent functional analysis of ABA-responsive promoters (e.g., promoter regions of wheat EM and rice Rab16A genes) has led to the identification of the ACGT-containing ABA-response elements (ABREs) (Guiltinan et al., 1990 ; Skriver et al., 1991 ; Vasil et al., 1995 ). As is understood for the promoters of various heat shock response genes (Scharf et al., 2001 ), a functional ABA-responsive promoter is reported to contain multiple ABREs (Skriver et al., 1991 ; Vasil et al., 1995 ).

The method of differential display, using reverse transcriptase and the polymerase chain reaction (DDRT-PCR), was developed and first reported by Liang and Pardee (1992) . It is a sensitive and powerful technique to isolate clones of eukaryotic genes regulated in response to various stimuli (e.g., biotic or abiotic stress). We report the cloning and identification of a novel gene HaABRC5 (sunflower ABA-responsive gene) using DDRT-PCR. HaABRC5 encodes a protein with a nuclear targeting motif whose expression is upregulated when exposed to drought, high salinity, or exogenous ABA. Sequence characterization of the genomic DNA upstream of HaABRC5 identified three ABA-responsive elements within the promoter region.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 LITERATURE CITED
 
Plant material and growth conditions
Sunflower (Helianthus annuus L.) plants of the variety Triumph 545 were grown from seed in the greenhouse under 16 h of light (250 µE · m–2 · s–1 minimum), ambient day/night temperature, and 60–80% humidity. One-week-old seedlings were transferred to PeatLite composite soil (peat compost : vermiculite, 1 : 1, Piedmont Farm and Nursery Supply, Spartanburg, South Carolina, USA), watered daily with tap water, and fertilized weekly with 1 : 250 Peters soluble fertilizer (20–10–20, Piedmont Farm and Nursery Supply). Roots and shoots of seedlings and leaves of 1-mo-old plants were collected for RNA extraction. Each extraction was repeated at least twice, and each experiment described below was repeated at least twice.

For drought treatment, 1-wk-old seedlings were drought stressed by air-drying for 10 h. Control seedlings were either untreated or removed from the soil and transferred to a beaker of water. Roots and shoots from treated and control seedlings were collected separately for RNA extraction. As estimated by comparisons of wet and dry mass measurements, the water content decreased approximately 10% after air-drying the seedlings. In other experiments, 1-mo-old plants were drought treated by withholding water for up to 12 d. Leaves from treated and control plants were collected every 2 d for RNA extraction. Some of the drought treated plants were allowed to recover by rewatering following the 6 d of treatment. These plants were watered once a day for two additional days and then the leaves were harvested for RNA extraction.

For high salinity treatment, 1-wk-old seedlings were transferred to a beaker containing aqueous 250 mmol/L NaCl solution for 6 h. Control seedlings were transferred to a beaker containing water for 6 h. Roots and shoots from stressed and control seedlings were collected separately for RNA extraction. The water content decreased approximately 10% when seedlings were treated with a 250 mmol/L NaCl solution (Liu and Baird, 2003 ).

For exogenous ABA treatment, 1-wk-old seedlings were transferred to a container of 100 µmol/L ABA solution (mixed isomers, ± cis/trans, Sigma, St. Louis, Missouri, USA) for 24 h. Control seedlings were transferred to water. Roots and shoots from treated and control seedlings were collected separately for RNA extraction.

Cloning and sequencing
Total RNA was isolated from 1 g of tissue from control plants and from stressed plants using an RNAqueous kit (Ambion, Austin, Texas, USA). DNA contamination was removed using a MessageClean kit (GenHunter, Nashville, Tennessee, USA). Using differential display reverse transcriptase (DDRT)-PCR, we previously isolated a cDNA fragment (clone RSC5-U, GenBank accession number: BG734522) from sunflower seedling roots that was upregulated by salinity stress (Liu and Baird, 2003 ). To complete the full-length cDNA sequence (designated HaABRC5), the missing 5' portion was cloned by rapid amplification of cDNA end (RACE) using a GeneRacer kit (Invitrogen, Carlsbad, California, USA) according to the manufacturer's protocol. Only 5'-RACE was performed because poly(dT) primer was used for DDRT-PCR. The gene-specific primers (RSC5R1: 5'-CCGAGCTATTAAGTGAGCCAAATCG-3'; and RSC5R2: 5'-TCCAAGCCATGAGGGAGCAATGTGTC-3') used for RACE were based on the sequence of RSC5-U. The genomic DNA sequence upstream of the transcription start site for HaABRC5 was cloned by rapid amplification of the genomic end (RAGE, Liu and Baird, 2001 ). The cloning experiments were repeated twice to confirm the results.

The RACE and RAGE products were cloned into the pGEM-T Easy vector (Promega, Madison, Wisconsin, USA). DNA sequencing (i.e., complete overlap, in two directions) was performed on an ABI (Perkin-Elmer, Branchburg, New Jersey, USA) model 373 automated DNA sequencer, using T7 and SP6 primers, and the Prism Dye Terminator kit (ABI). Both DNA strands were sequenced completely to confirm the identity of each nucleotide.

Quantitative RT-PCR
Quantitative RT-PCR was used to analyze the expression pattern of HaABRC5. The primer pair for amplification of plant 18S rRNA (as the internal standard) and the 18S rRNA inhibitory competitive primer pair, were from QuantumRNA kit (Ambion). Each RT reaction contained 5 mmol/L KCl, 10 mmol/L Tris-HCl (pH 8.3), 4 mmol/L MgCl2, 25 µmol/L of each dNTP, 0.2 µmol/L random hexamers (Promega, Madison, Wisconsin, USA), 1 µg total RNA, and 100 units MMLV (Moloney Murine Leukemia Virus) reverse transcriptase (GenHunter). For each PCR reaction, one-tenth of the cDNA was added in a cocktail containing 100 µmol/L of each dNTP, 0.2 µL of {alpha}-32P-dCTP (New England Nuclear, Boston, Massachusetts, USA), 1 µmol of each gene-specific primer pair (RSC5RT5': GTAGGCATACCAAATGAAGTCGAAAG and RSC5RT3': AGCTAAGTCGAGCCAAACCGA), 1 µmol/L of 18S rRNA primer pair and 18S rRNA inhibitory primer pair mixture (1 : 9), 0.5 units of Taq DNA polymerase (Promega) with its own buffer containing 1.5 mmol/L MgCl2. After denaturation at 95°C for 3 min, 20 PCR cycles (95°C for 30 s, 60°C for 30 s, and 72°C for 30 s) were performed, followed by a 1-min extension step at 72°C. One-fifth of the PCR product was analyzed on a 6% denaturing acrylamide gel. All quantitative RT-PCR amplified DNA fragments were sequenced to confirm their identities.

Each quantitative RT-PCR experiment was repeated at least twice. The intensity of each amplification product was quantified by scanning densitometry using a Fuji Image System (Fujifilm, Duluth, Georgia, USA). The putative HaABRC5 amplification products from each tissue or treatment time-point were sequenced to confirm their identity.

Southern blot analysis
Total DNA was isolated from 2 g of seedling tissue using a Nucleon Phytopure Plant DNA Extraction kit (Amersham, Piscataway, New Jersey, USA). The purified DNA was then digested to completion using the restriction enzymes BamHI and HindIII, individually. For each digestion, at least 10 µg of purified DNA was mixed with a five-fold excess of enzyme and incubated over night at 37°C. The digested DNA was size fractionated in 1% agarose gels. The DNA fragments on the gel were transferred onto Hybond N+ membrane (Amersham) in 5x SSPE (0.9 mol/L NaCl, 50 mmol/L sodium phosphate, pH 7.7, and 0.5 mmol/L EDTA) containing 0.4 mol/L NaOH. The membrane was renatured in neutralization buffer (1 mol/L Tris-HCl, pH 7.4, and 1.5 mol/L NaCl) for 5 min, and the DNA crosslinked to the membrane with UV light irradiation (Cross Linker 1800, Stratagene). The cDNA clone of HaABRC5 was radiolabeled by PCR using the primers RSC5-ATG: 5'-ATGAAGGAAACTCAAGATTCAAGAGA-3'; and RSC5-UR1: 5'-CCGAGCTATTAAGTGAGCCAAATCG-3'. PCR amplification was performed in a 50-µL reaction containing 10 ng HaABRC5 cDNA, 100 nmol/L of each primer, 2 µL of {alpha}-33P-dCTP (NEN), 2 µmol/L each dNTP, and 5 units of Taq polymerase (Promega). A program of 15 cycles of 30 s denaturation at 95°C, 30 s annealing at 60°C, and 90 s extension at 72°C was used. The labeled probe was column purified. Hybridization and washes followed standard methods (Sambrook et al., 1989 ).


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 LITERATURE CITED
 
Cloning and characterization of HaABRC5 cDNA
We cloned a cDNA of 812 nucleotides (nt) that contained 423 nt of coding region flanked by 58 nt of the 5' untranslated region (UTR) and 331 nt of 3' UTR. DNA sequence analysis revealed an open-reading frame encoding 141 amino acid residues (Fig. 1). Because the 3' UTR of HaABRC5 did not appear to contain a canonical polyadenylation tract, the sequence AATAT (nt 1025–1029, Fig. 1) likely functions as the polyadenylation signal (Bonham-Smith et al., 1992 ). This same putative polyadenylation signal was identified in another stress-responsive gene isolated from sunflower (Liu, 2002 ).



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 1. HaABRC5 DNA from Helianthus annuus and the deduced amino acid sequences. The cDNA sequence appears in uppercase and the possible promoter sequence appears in lowercase; the predicted eukaryotic promoter is in boldface lowercase; the three ACGT-containing ABREs are underlined (nt 27–33; 117–122, 157–161); the predicted ATG initiation and TGA stop codons are in boldface type; the putative polyadenylation signal is underlined (nt 1025–1029)

 
The 5' UTR of HaABRC5 was found to harbor a short pyrimidine signal (terminal oligo pyrimidine, TOP) at the very 5' end of the transcript (nt 227–238, Fig. 1). Sequence comparisons showed a strong similarity in the transcription start site region between HaABRC5 and a number of TOP genes (Fig. 2). HaABRC5 has a single nucleotide mismatch over the minimum 11 pyrimidine stretch, a frequency that would be expected at random less than 0.05% of the time. It is suggested that the TOP genes (i.e., genes encoding ribosomal proteins, translation factors, and a heterogeneous nuclear ribonucleoprotein, hnRNP A1) are regulated at the transcriptional level in a growth-dependent manner (Meyuhas et al., 1996 ; Amaldi and Pierandrei-Amaldi, 1997 ; Camacho-Vanegas et al., 1997 ).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2. Comparison of the sequences surrounding the transcription start site of HaABRC5 from Helianthus annuus with those of human TOP genes: heterogeneous nuclear ribonucleoprotein hnRNP A1 (Camacho-Vanegas et al., 1997 ), translation factor eEF1{alpha} (Meyuhas et al., 1996 ), ribosomal proteins: rpS4X, rpS4Y, rpS6, and rpS8 (Meyuhas et al., 1996 ). The pyrimidine tracts are underlined. The transcription start sites are aligned at the arrow

 
The predicted 141 amino acid of HaABRC5 has a calculated molecular mass of 16.1 kDa and a predicted pI (isoelectric pH) of 9.79. Although HaABRC5 has no homology to any protein of known function, some characteristic features were identified. HaABRC5 contains a high percentage (21%) of basic amino acids (e.g., Arg, Lys, and His). A nuclear targeting sequence (Dingwall and Laskey, 1991 ) was found in the N-terminal region between amino acid residues 36 and 54 of HaABRC5. Searching the databases using the predicted amino acid sequence revealed that HaABRC5 had strong homology to some putative/hypothetical protein sequences of Arabidopsis (Fig. 3). Although these putative sequences are different in length, they all have three conserved domains: an N-terminal Leu-rich domain (domain-1, Fig. 3), a domain for nuclear targeting/localization (domain-2, Fig. 3), and a C-terminal basic domain (domain-3, Fig. 3). Furthermore, the basic amino acid residues are highly conserved within the nuclear targeting sequence. Therefore, we suggest that HaABRC5 is a novel protein that functions in the nucleus.



View larger version (105K):
[in this window]
[in a new window]
 
Fig. 3. HaABRC5 amino acid sequence from Helianthus annuus in alignment with several Arabidopsis unknown/hypothetical proteins with GenBank access numbers NP_189598, AAF27062 NP_172892, AAL07175 AF385741, and BAB01982 respectively. Domains 1, 2, and 3 are marked for three highly conserved regions of these deduced amino acid sequences. The conserved basic amino acid residues in domain 2 are indicated with asterisks

 
To investigate the organization of HaABRC5 in the sunflower nuclear genome, DNA gel blot (Southern) analysis was performed. Genomic DNA from sunflower was digested with individual endonucleases and hybridized with a radiolabeled HaABRC5 cDNA probe. Southern blot analysis showed that HaABRC5 is a member of a small gene family. There appears to be 2–4 copies of HaABCR5, or HaABRC5-like sequences, in the sunflower genome (Fig. 4). For example, probing HindII-digested DNA revealed bands of approximately 5.5 and 11.4 kilobases (kb), while EcoRI digests revealed bands of 2.8, 8.4, and 13 kb in size. Because HaABRC5 has an EcoRI site near its 3' end (and lacks any HindIII sites), the 2.8 kb fragment could be a doublet, consistent with its increased signal intensity. Thus, the four fragments are indicative of four gene copies. On the other hand, one or both of the remaining two fragments (8.4 and 13 kb) could be 3' portions of the gene, where sequence similarity to the probe may be reduced. This interpretation, along with the results of the HindIII digest, is consistent with just two members in the gene family. Final determination of gene family size will require screening a genomic/BAC (bacterial artificial chromosome) library.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 4. Southern blot analysis of the HaABRC5 gene from Helianthus annuus. Genomic DNA was digested with EcoRI (E) or HindIII (H) and hybridized with radiolabeled HaABRC5 cDNA. M, molecular size markers, 1 kb Plus DNA Ladder (Life Technologies, Rockville, Maryland, USA)

 
Expression of HaABRC5 is upregulated by drought, high salinity, and ABA
Quantitative RT-PCR was used to reinvestigate preliminary differential display findings and to extend the analysis of HaABRC5 expression patterns. All RT-PCR products were cloned and sequenced to confirm their identity, and amplification from the 18S rRNA transcript was used as an internal standard. For analysis of HaABRC5 expression in leaves, the control 18S rRNA primer pair amplified a single, 315-bp fragment to nearly identical concentrations when using first strand cDNAs produced from either treated or control leaves. Similarly, for expression of HaABRC5 in seedlings, the 18S rRNA control primers amplified a 315-bp fragment to identical concentrations from cDNAs produced from roots or shoots of treated or control seedlings.

HaABRC5 was constitutively expressed at a very low level in all organs tested (leaves, seedling roots, and seedling shoots). Although in original DDRT-PCR experiments expression of HaABRC5 was initially found to be upregulated in roots but not in shoots of salt-treated seedlings (Liu and Baird, 2003 ), when analyzed by quantitative RT-PCR, the expression of HaABRC5 was found to be upregulated in both seedling roots and shoots exposed to high salinity (Fig. 5). This discrepancy in results between analytical methods is probably due to the limitations of DDRT-PCR (Debouck, 1995 ). For example, the presence of RSC5-U in seedling shoots was investigated by excising the portion of the DDRT-PCR gel from control and treated shoots corresponding to that region of the gel where RSC5-U was originally isolated from treated roots. Reamplification of the extracted cDNAs with the original, nonspecific DDRT-PCR primers failed to produce a product identical in sequence to RSC5-U. It now seems likely that RSC5-U (HaARBC5) transcripts were present in treated seedling shoots, but were in such low abundance they were not as competitive a substrate as other, more abundant constitutively expressed sequences.



View larger version (86K):
[in this window]
[in a new window]
 
Fig. 5. Expression pattern of HaABRC5 from Helianthus annuus in response to high salinity, drought, and exogenously applied ABA. The cDNAs were synthesized from total RNAs isolated from control seedling roots (RC) and seedling roots treated with 250 mmol NaCl (RS), drought (RD), or ABA (RA), control seedling shoots (SC) and seedling shoots treated with 250mmol NaCl (SS), drought (SD), or ABA (SA), leaves from control (LC) and drought-treated (LD) plants. *The gene expression level for each sample was determined by the relative signal intensity to that of 18S rRNA gene. Error bars represent 10% confidence limits

 
In NaCl-treated seedlings, the expression level of HaABRC5 was increased twofold in roots and fivefold in shoots. In addition, the expression level of HaABRC5 increased by three-, five- and sevenfold in seedling roots, seedling shoots, and leaves, respectively, during drought treatment (Fig. 5). Furthermore, upregulation of HaABRC5 gene expression was observed in seedling roots (ninefold) and shoots (fourfold) following exogenous application of ABA (Fig. 5). In seedling shoots, the upregulated steady-state expression levels of HaARCB5 were almost identical in the samples exposed to high salinity, drought, or ABA. Overall, upregulation of HaABRC5 was greatest in roots in the ABA-treated samples, compared to the drought- and NaCl-treated samples. Taken together, these observations suggest that HaABRC5 may be an ABA responsive gene. This is consistent with the fact that roots are more sensitive to ABA and that, in many instances, roots are the first organs to encounter water stress (Sauter et al., 2001 ).

Expression of HaABRC5 in drought-treated leaves
In all examined samples exposed to drought conditions or treated with NaCl, the highest expression level of HaABRC5 was observed in drought-treated leaves. Therefore, HaABRC5 expression in response to drought stress was analyzed further (Fig. 6). Sunflower leaves were collected from 1-mo-old plants drought treated for up to 12 d. The steady-state expression of HaABRC5 was up-regulated to approximately 1.3-fold after 2 d of drought treatment. After this time, the expression level increased significantly and reached its maximum by 6 d of drought treatment. By day 6, the level of HaABRC5 transcript increased greater than sevenfold above that of the control (untreated) leaves. The level of HaABRC5 transcript was stable for up to 10 d. After 12 d of drought treatment, the level of HaABRC5 transcript in leaves decreased to basically the same as that in untreated controls. Interestingly, rewatering the 6-d drought-treated plants eliminated the effect of drought on HaABRC5 gene expression. The expression of HaABRC5 in the leaves of rewatered plants returned to nearly the same level as that of the untreated leaves (Fig. 6).



View larger version (78K):
[in this window]
[in a new window]
 
Fig. 6. Expression of HaABRC5 in leaves of drought-treated plants of Helianthus annuus. The cDNAs were synthesized from leaves of plants drought treated for 0, 2, 4, 6, 8, 10, or 12 d and from plants rewatered (RW) after day 6 of drought treatment. *The expression level for each sample was determined by the relative signal intensity to that of the 18S rRNA gene internal standard. Error bars represent 10% confidence limits

 
Sequence analysis of HaABRC5 promoter region
An 880-bp DNA fragment located upstream of the 5' end of clone RSC5-U was isolated by RAGE (Liu and Baird, 2001 ). By comparing the genomic DNA sequences to the original cDNA sequences, we identified a promoter region of 229 nt upstream of the transcriptional start of HaABRC5. A putative eukaryotic promoter sequence was located 19 nt upstream of the transcriptional start site (between nt 161 and 211, Fig. 1). Three ACGT-containing ABREs (ACGTGCC [nt 27–33], CACGTG [nt 117–122] and TACGT [nt 157–161]) were identified in this promoter (Fig. 1). ACGTGCC and CACGTG motifs have been identified in the promoters of many ABA-responsive genes including Rd29A and Rd29B (Yamaguchi-Shinozaki and Shinozaki, 1994 ), COR15a (Baker et al., 1994 ), rbcS (Giuliano et al., 1988 ), Em (Razik and Quatrano, 1997 ), and Rab16A (Skriver et al., 1991 ). In agreement with the previous studies (reviewed by Busk and Pages, 1998 ), the ABREs in HaABRC5 also were found within 300 nt upstream of the transcription start site. The active promoter for ABA-responsive genes requires multiple ACGT-containing ABREs (Skriver et al., 1991 ; Vasil et al., 1995 ). Therefore, the 229 nt upstream of HaABRC5 is very likely an ABA-responsive promoter.

HaABRC5 is a novel plant gene
Abscisic acid plays important roles in plant environmental stress response and tolerance. In vegetative tissues, endogenous ABA levels increase in response to dehydration (Zeevaart and Creelman, 1988 ) or by exposure to high salinity (Moons et al., 1997 ). Therefore, ABA-responsive genes also can be regulated by drought or salinity. HaABRC5, which was first isolated from NaCl-treated seedlings, is an ABA-responsive gene because three ACGT-containing ABREs are present within 300 nt of its promoter region (Fig. 1) and the highest level of HaABRC5 transcript was observed in roots treated with ABA (Fig. 5).

Characterization of the HaABRC5 sequence revealed several other interesting features. HaABRC5 probably encodes a nuclear protein because its deduced amino acid sequence contains a high level of basic amino acids and a nuclear targeting/localization signal (NLS, domain 2). The presence of a terminal oligo-pyrimidine tract in its transcript suggests that HaABRC5 is a TOP gene and that its expression is regulated in relationship to plant cell growth. The TOP genes include two major groups (i.e., ribosomal protein genes and translation elongation factors) as well as a hnRNP A1 gene (Meyuhas et al., 1996 ; Amaldi and Pierandrei-Amaldi, 1997 ; Camacho-Vanegas et al., 1997 ). The products of all of these genes are involved in protein translation. Both translation elongation factors and hnRNP A1 are able to interact with RNA molecules. Like hnRNP A1, a nuclear-cytoplasmic shuttle protein, HaABRC5 contains both the TOP-related sequence in its 5'-untranslated region and an NLS. As such, HaABRC5 may have a function similar to that of hnRNP A1 (e.g., regulating translation, possibly through RNA modification, during stress response in sunflower). In rice tungro bacilliform virus, a protein RTBV P2 containing a short basic domain at its C terminal proved to have the capacity to bind both DNA and RNA (Jacquot et al., 1997 ). HaABRC5 contains a high percentage of basic amino acid residues and a conserved basic domain (domain-3) at its C terminal. Therefore, it will be worthwhile to investigate whether HaABRC5 has DNA/RNA-binding activity.

In searching available databases with either the complete DNA or deduced amino acid sequence, HaABRC5 had homology only to a few genes from Arabidopsis (Fig. 3). As three conserved domains were identified in HaABRC5, these conserved amino acid sequences also were used to search ESTs (expressed sequence tags) from the databases. A number of partial cDNA sequences encoded amino acid sequences similar to these domains (Fig. 7). Interestingly, all of these cDNAs are from plants (Fig. 7). Furthermore, the Leu residues in domain 1 (Leu-rich domain), the basic amino acid residues of domain 2 (nuclear targeting signal) and domain 3 (C terminal basic domain) are conserved in all EST sequences aligned. These observations imply that not only are these domains conserved, but also they are very likely to be unique to plant proteins. Therefore, we suggest that HaABRC5 is a plant-specific gene encoding a novel nuclear protein.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 7. The database search results showing ESTs with the three conserved domains of HaABRC5 from Helianthus annuus. (A) Domain 1 in alignment with the deduced amino acid sequences of ESTs: BE037955 (Arabidopsis), AV527976 (Arabidopsis), BG131346 (tomato), BF425599 (cotton), BG593275 (potato), BG103924 (sorghum), AW201972 (cotton), and BE529590 (Arabidopsis). The conserved Leu residues are indicated with asterisks. (B) Domain 2 in alignment with the deduced amino acid sequences of ESTs: AW621557 (tomato), BG593275 (potato), AW099742 (cotton), AV527976 (Arabidopsis), AW261368 (corn), BG948713 (sorghum), C97603 (rice), and BI960115 (barley). The conserved basic amino acid residues are indicated with asterisks. (C) Domain 3 in alignment with the deduced amino acid sequences of Arabidopsis ESTs: AY056326, AC008262, and AF385741. The conserved basic amino acid residues are indicated with asterisks

 


    FOOTNOTES
 
1 The authors thank Ms. Rebecca Ackerman of the Clemson University DNA sequencing facility, and Triumph Seed Co. Inc. This work was supported by the South Carolina Agriculture Experiment Station and a grant from U. S.–A. I. D. University Linkages Project II (93/01/35; 263-0211) to W. V. B. Back

5 vbaird{at}clemson.edu Back


    LITERATURE CITED
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 LITERATURE CITED
 
Amaldi F. P. Pierandrei-Amaldi 1997 TOP genes: a translationally controlled class of genes including those coding for ribosomal proteins. In P. Jeanteur [ed.], Cytoplasmic fate of eukaryotic mRNA, 1–17. Springer-Verlag, Heidelberg, Germany

Baker S. S. K. S. Wilhelm M. F. Thomashow 1994 The 5'-region of Arabidopsis thaliana cor15a has cis-acting elements that confer cold-, drought- and ABA-regulated gene expression. Plant Molecular Biology 24: 701-713[CrossRef][ISI][Medline]

Bohnert H. J. et al 2001 A genomics approach towards salt stress tolerance. Plant Physiology and Biochemistry 39: 295-311[CrossRef][ISI]

Bonham-Smith P. C. T. L. Oancia M. M. Moloney 1992 Cytoplasmic ribosomal protein S15a from Brassica napus: molecular cloning and developmental expression in mitotically active tissues. Plant Molecular Biology 18: 909-919[CrossRef][ISI][Medline]

Bray E. 1993 Molecular responses to water deficit. Plant Physiology 103: 1035-1040[ISI][Medline]

Busk P. K. M. Pages 1998 Regulation of abscisic acid-induced transcription. Plant Molecular Biology 37: 425-435[CrossRef][ISI][Medline]

Camacho-Vanegas O. F. Weighardt C. Ghigna F. Amaldi S. Riva G. Biamonti 1997 Growth-dependent and growth-independent translation of messengers for heterogeneous nuclear ribonucleoproteins. Nucleic Acids Research 25: 3950-3954[Abstract/Free Full Text]

Debouck C. 1995 Differential display or differential dismay?. Current Opinion in Biotechnology 6: 597-599

Dingwall C. R. A. Laskey 1991 Nuclear targeting sequences—a consensus?. Trends in Biochemical Sciences 16: 478-481[CrossRef][ISI][Medline]

Giuliano G. E. Pichersky V. S. Malik M. P. Timko P. A. Scolnik A. R. Cashmore 1988 An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene. Proceedings of the National Academy of Sciences, USA 85: 7089-7093[Abstract/Free Full Text]

Guiltinan M. J. W. R. Marcotte R. S. Quartrano 1990 A plant leucine zipper protein that recognizes an abscisic acid response element. Science 250: 267-270[Abstract/Free Full Text]

Ingram J. D. Bartels 1996 The molecular basis of dehydration tolerance plants. Annual Review of Plant Physiology and Plant Molecular Biology 47: 377-403[CrossRef][ISI][Medline]

Jacquot E. M. Keller P. Yot 1997 A short basic domain supports a nucleic acid-binding activity in the rice tungro bacilliform virus open reading frame 2 product. Virology 239: 352-359[CrossRef][ISI][Medline]

Kawasaki S. C. Borchert M. Deyholos H. Wang S. Brazille K. Kawai D. Galbraith H. J. Bohnert 2001 Gene expression profiles during the initial phase of salt stress in rice. Plant Cell 13: 889-905[Abstract/Free Full Text]

Liang P. A. B. Pardee 1992 Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257: 967-971[Abstract/Free Full Text]

Liu X. N. 2002 Cloning and characterization of drought-/salinity-responsive genes from sunflower. Ph.D. dissertation (Disssertation Abstracts number ATT 3045216), Clemson University, Clemson, South Carolina, USA

Liu X. N. W. V. Baird 2001 Rapid amplification of genomic DNA ends by NlaIII partial digestion and polynucleotide tailing. Plant Molecular Biology Reporter 19: 261-267[ISI]

Liu X. N. W. V. Baird 2003 Differential expression of genes regulated in response to drought or salinity stress in sunflower. Crop Science 43: 678-687[Abstract/Free Full Text]

Meyuhas O. D. Avni S. Shama 1996 Translational control of ribosomal protein mRNAs in eukaryotes. In J. W. B. Hershey, M. B. Mathews, and N. Sonneberg [eds.], Translational control, 363–388. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA

Moons A. E. Prinsen G. Bauw M. Van Montagu 1997 Antagonistic effects of abscisic acid and jasmonates on salt stress-inducible transcripts in rice roots. Plant Cell 9: 2243-2259[Abstract]

Ramani S. S. K. Apte 1997 Transient expression of multiple genes in salinity-stress young seedlings of rice (Oryza sativa L.) cv. bura rata. Biochemical and Biophysical Research Communications 233: 663-667[CrossRef][ISI][Medline]

Razik M. A. R. S. Quatrano 1997 Effect of the nuclear factors EmBP1 and viviparous1 on the transcription of the Em gene in HeLa nuclear extracts. Plant Cell 9: 1791-1803[Abstract]

Romo S. E. Labrador B. Dopico 2001 Water stress-regulated gene expression in Cicer arietinum seedlings and plants. Plant Physiology and Biochemistry 39: 1017-1026[CrossRef][ISI]

Sambrook J. E. F. Fritch T. Maniatis 1989 Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA

Sauter A. W. J. Davies W. Hartung 2001 The long-distance abscisic acid signal in the droughted plant: the fate of the hormone on its way from root to shoot. Journal of Experimental Botany 52: 1991-1997[Abstract/Free Full Text]

Scharf K.-D. M. Siddique E. Vierling 2001 The expanding family of Arabidopsis thaliana small heat stress proteins and a new family of proteins containing {alpha}-crystallin domains (Acd proteins). Cell Stress and Chaperones 6: 225-237[ISI][Medline]

Seki M. M. Narusaka H. Abe M. Kasuga K. Yamaguchi-Shinozaki P. Carninci Y. Hayashizaki K. Shinozaki 2001 Monitoring the expression pattern of 1300 Arabidopsis genes under drought and cold stresses by using a full-length cDNA microarray. Plant Cell 13: 61-72[Abstract/Free Full Text]

Skriver K. F. L. Olsen J. Roger J. Mundy 1991 Cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid. Proceedings of the National Academy of Sciences, USA 88: 7266-7270[Abstract/Free Full Text]

Tabaeizadeh Z. 1998 Drought-induced responses in plant cells. International Review of Cytology 182: 193-247[ISI][Medline]

Vasil V. W. R. Marcotte Jr. L. Rosenkrans S. M. Cocciolone I. K. Vasil R. S. Quatrano D. R. McCarty 1995 Overlap of Viviparous1 (VP1) and abscisic acid response elements in the Em promoter: G-box elements are sufficient but not necessary for VP1 transactivation. Plant Cell 7: 1511-1518[Abstract]

Yamaguchi-Shinozaki K. K. Shinozaki 1994 A novel cis-acting element in an Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high-salt stress. Plant Cell 6: 251-264[Abstract]

Zeevaart J. A. D. R. A. Creelman 1988 Metabolism and physiology of abscisic acid. Annual Review of Plant Physiology and Plant Molecular Biology 39: 439-473[CrossRef][ISI]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via ISI Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, X.
Right arrow Articles by Vance Baird, Wm.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Liu, X.
Right arrow Articles by Vance Baird, Wm.
Agricola
Right arrow Articles by Liu, X.
Right arrow Articles by Vance Baird, Wm.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS