|
|
||||||||
|
What's this? |
Genetics and Molecular Biology |
2Horticulture Department and Genetics Graduate Program, Clemson University; 3Department of Plant Biology, 190 ERML, University of Illinois, Urbana, Illinois 61801 USA; 4Horticulture Department, Poole Agriculture Center, Box 340375, Clemson University, Clemson, South Carolina 29634-0375 USA
Received for publication May 22, 2003. Accepted for publication September 26, 2003.
| ABSTRACT |
|---|
|
|
|---|
Key Words: abscisic acid cDNA cloning environmental stress gene expression gene regulation promoter sunflower
| INTRODUCTION |
|---|
|
|
|---|
The plant phytohormone abscisic acid (ABA) is involved in osmotic stress response (i.e., drought and salinity) and has been shown to regulate the expression of various stress-responsive genes (Bray, 1993
). Subsequent functional analysis of ABA-responsive promoters (e.g., promoter regions of wheat EM and rice Rab16A genes) has led to the identification of the ACGT-containing ABA-response elements (ABREs) (Guiltinan et al., 1990
; Skriver et al., 1991
; Vasil et al., 1995
). As is understood for the promoters of various heat shock response genes (Scharf et al., 2001
), a functional ABA-responsive promoter is reported to contain multiple ABREs (Skriver et al., 1991
; Vasil et al., 1995
).
The method of differential display, using reverse transcriptase and the polymerase chain reaction (DDRT-PCR), was developed and first reported by Liang and Pardee (1992)
. It is a sensitive and powerful technique to isolate clones of eukaryotic genes regulated in response to various stimuli (e.g., biotic or abiotic stress). We report the cloning and identification of a novel gene HaABRC5 (sunflower ABA-responsive gene) using DDRT-PCR. HaABRC5 encodes a protein with a nuclear targeting motif whose expression is upregulated when exposed to drought, high salinity, or exogenous ABA. Sequence characterization of the genomic DNA upstream of HaABRC5 identified three ABA-responsive elements within the promoter region.
| MATERIALS AND METHODS |
|---|
|
|
|---|
For drought treatment, 1-wk-old seedlings were drought stressed by air-drying for 10 h. Control seedlings were either untreated or removed from the soil and transferred to a beaker of water. Roots and shoots from treated and control seedlings were collected separately for RNA extraction. As estimated by comparisons of wet and dry mass measurements, the water content decreased approximately 10% after air-drying the seedlings. In other experiments, 1-mo-old plants were drought treated by withholding water for up to 12 d. Leaves from treated and control plants were collected every 2 d for RNA extraction. Some of the drought treated plants were allowed to recover by rewatering following the 6 d of treatment. These plants were watered once a day for two additional days and then the leaves were harvested for RNA extraction.
For high salinity treatment, 1-wk-old seedlings were transferred to a beaker containing aqueous 250 mmol/L NaCl solution for 6 h. Control seedlings were transferred to a beaker containing water for 6 h. Roots and shoots from stressed and control seedlings were collected separately for RNA extraction. The water content decreased approximately 10% when seedlings were treated with a 250 mmol/L NaCl solution (Liu and Baird, 2003
).
For exogenous ABA treatment, 1-wk-old seedlings were transferred to a container of 100 µmol/L ABA solution (mixed isomers, ± cis/trans, Sigma, St. Louis, Missouri, USA) for 24 h. Control seedlings were transferred to water. Roots and shoots from treated and control seedlings were collected separately for RNA extraction.
Cloning and sequencing
Total RNA was isolated from 1 g of tissue from control plants and from stressed plants using an RNAqueous kit (Ambion, Austin, Texas, USA). DNA contamination was removed using a MessageClean kit (GenHunter, Nashville, Tennessee, USA). Using differential display reverse transcriptase (DDRT)-PCR, we previously isolated a cDNA fragment (clone RSC5-U, GenBank accession number: BG734522) from sunflower seedling roots that was upregulated by salinity stress (Liu and Baird, 2003
). To complete the full-length cDNA sequence (designated HaABRC5), the missing 5' portion was cloned by rapid amplification of cDNA end (RACE) using a GeneRacer kit (Invitrogen, Carlsbad, California, USA) according to the manufacturer's protocol. Only 5'-RACE was performed because poly(dT) primer was used for DDRT-PCR. The gene-specific primers (RSC5R1: 5'-CCGAGCTATTAAGTGAGCCAAATCG-3'; and RSC5R2: 5'-TCCAAGCCATGAGGGAGCAATGTGTC-3') used for RACE were based on the sequence of RSC5-U. The genomic DNA sequence upstream of the transcription start site for HaABRC5 was cloned by rapid amplification of the genomic end (RAGE, Liu and Baird, 2001
). The cloning experiments were repeated twice to confirm the results.
The RACE and RAGE products were cloned into the pGEM-T Easy vector (Promega, Madison, Wisconsin, USA). DNA sequencing (i.e., complete overlap, in two directions) was performed on an ABI (Perkin-Elmer, Branchburg, New Jersey, USA) model 373 automated DNA sequencer, using T7 and SP6 primers, and the Prism Dye Terminator kit (ABI). Both DNA strands were sequenced completely to confirm the identity of each nucleotide.
Quantitative RT-PCR
Quantitative RT-PCR was used to analyze the expression pattern of HaABRC5. The primer pair for amplification of plant 18S rRNA (as the internal standard) and the 18S rRNA inhibitory competitive primer pair, were from QuantumRNA kit (Ambion). Each RT reaction contained 5 mmol/L KCl, 10 mmol/L Tris-HCl (pH 8.3), 4 mmol/L MgCl2, 25 µmol/L of each dNTP, 0.2 µmol/L random hexamers (Promega, Madison, Wisconsin, USA), 1 µg total RNA, and 100 units MMLV (Moloney Murine Leukemia Virus) reverse transcriptase (GenHunter). For each PCR reaction, one-tenth of the cDNA was added in a cocktail containing 100 µmol/L of each dNTP, 0.2 µL of
-32P-dCTP (New England Nuclear, Boston, Massachusetts, USA), 1 µmol of each gene-specific primer pair (RSC5RT5': GTAGGCATACCAAATGAAGTCGAAAG and RSC5RT3': AGCTAAGTCGAGCCAAACCGA), 1 µmol/L of 18S rRNA primer pair and 18S rRNA inhibitory primer pair mixture (1 : 9), 0.5 units of Taq DNA polymerase (Promega) with its own buffer containing 1.5 mmol/L MgCl2. After denaturation at 95°C for 3 min, 20 PCR cycles (95°C for 30 s, 60°C for 30 s, and 72°C for 30 s) were performed, followed by a 1-min extension step at 72°C. One-fifth of the PCR product was analyzed on a 6% denaturing acrylamide gel. All quantitative RT-PCR amplified DNA fragments were sequenced to confirm their identities.
Each quantitative RT-PCR experiment was repeated at least twice. The intensity of each amplification product was quantified by scanning densitometry using a Fuji Image System (Fujifilm, Duluth, Georgia, USA). The putative HaABRC5 amplification products from each tissue or treatment time-point were sequenced to confirm their identity.
Southern blot analysis
Total DNA was isolated from 2 g of seedling tissue using a Nucleon Phytopure Plant DNA Extraction kit (Amersham, Piscataway, New Jersey, USA). The purified DNA was then digested to completion using the restriction enzymes BamHI and HindIII, individually. For each digestion, at least 10 µg of purified DNA was mixed with a five-fold excess of enzyme and incubated over night at 37°C. The digested DNA was size fractionated in 1% agarose gels. The DNA fragments on the gel were transferred onto Hybond N+ membrane (Amersham) in 5x SSPE (0.9 mol/L NaCl, 50 mmol/L sodium phosphate, pH 7.7, and 0.5 mmol/L EDTA) containing 0.4 mol/L NaOH. The membrane was renatured in neutralization buffer (1 mol/L Tris-HCl, pH 7.4, and 1.5 mol/L NaCl) for 5 min, and the DNA crosslinked to the membrane with UV light irradiation (Cross Linker 1800, Stratagene). The cDNA clone of HaABRC5 was radiolabeled by PCR using the primers RSC5-ATG: 5'-ATGAAGGAAACTCAAGATTCAAGAGA-3'; and RSC5-UR1: 5'-CCGAGCTATTAAGTGAGCCAAATCG-3'. PCR amplification was performed in a 50-µL reaction containing 10 ng HaABRC5 cDNA, 100 nmol/L of each primer, 2 µL of
-33P-dCTP (NEN), 2 µmol/L each dNTP, and 5 units of Taq polymerase (Promega). A program of 15 cycles of 30 s denaturation at 95°C, 30 s annealing at 60°C, and 90 s extension at 72°C was used. The labeled probe was column purified. Hybridization and washes followed standard methods (Sambrook et al., 1989
).
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
|
|
|
|
HaABRC5 was constitutively expressed at a very low level in all organs tested (leaves, seedling roots, and seedling shoots). Although in original DDRT-PCR experiments expression of HaABRC5 was initially found to be upregulated in roots but not in shoots of salt-treated seedlings (Liu and Baird, 2003
), when analyzed by quantitative RT-PCR, the expression of HaABRC5 was found to be upregulated in both seedling roots and shoots exposed to high salinity (Fig. 5). This discrepancy in results between analytical methods is probably due to the limitations of DDRT-PCR (Debouck, 1995
). For example, the presence of RSC5-U in seedling shoots was investigated by excising the portion of the DDRT-PCR gel from control and treated shoots corresponding to that region of the gel where RSC5-U was originally isolated from treated roots. Reamplification of the extracted cDNAs with the original, nonspecific DDRT-PCR primers failed to produce a product identical in sequence to RSC5-U. It now seems likely that RSC5-U (HaARBC5) transcripts were present in treated seedling shoots, but were in such low abundance they were not as competitive a substrate as other, more abundant constitutively expressed sequences.
|
Expression of HaABRC5 in drought-treated leaves
In all examined samples exposed to drought conditions or treated with NaCl, the highest expression level of HaABRC5 was observed in drought-treated leaves. Therefore, HaABRC5 expression in response to drought stress was analyzed further (Fig. 6). Sunflower leaves were collected from 1-mo-old plants drought treated for up to 12 d. The steady-state expression of HaABRC5 was up-regulated to approximately 1.3-fold after 2 d of drought treatment. After this time, the expression level increased significantly and reached its maximum by 6 d of drought treatment. By day 6, the level of HaABRC5 transcript increased greater than sevenfold above that of the control (untreated) leaves. The level of HaABRC5 transcript was stable for up to 10 d. After 12 d of drought treatment, the level of HaABRC5 transcript in leaves decreased to basically the same as that in untreated controls. Interestingly, rewatering the 6-d drought-treated plants eliminated the effect of drought on HaABRC5 gene expression. The expression of HaABRC5 in the leaves of rewatered plants returned to nearly the same level as that of the untreated leaves (Fig. 6).
|
HaABRC5 is a novel plant gene
Abscisic acid plays important roles in plant environmental stress response and tolerance. In vegetative tissues, endogenous ABA levels increase in response to dehydration (Zeevaart and Creelman, 1988
) or by exposure to high salinity (Moons et al., 1997
). Therefore, ABA-responsive genes also can be regulated by drought or salinity. HaABRC5, which was first isolated from NaCl-treated seedlings, is an ABA-responsive gene because three ACGT-containing ABREs are present within 300 nt of its promoter region (Fig. 1) and the highest level of HaABRC5 transcript was observed in roots treated with ABA (Fig. 5).
Characterization of the HaABRC5 sequence revealed several other interesting features. HaABRC5 probably encodes a nuclear protein because its deduced amino acid sequence contains a high level of basic amino acids and a nuclear targeting/localization signal (NLS, domain 2). The presence of a terminal oligo-pyrimidine tract in its transcript suggests that HaABRC5 is a TOP gene and that its expression is regulated in relationship to plant cell growth. The TOP genes include two major groups (i.e., ribosomal protein genes and translation elongation factors) as well as a hnRNP A1 gene (Meyuhas et al., 1996
; Amaldi and Pierandrei-Amaldi, 1997
; Camacho-Vanegas et al., 1997
). The products of all of these genes are involved in protein translation. Both translation elongation factors and hnRNP A1 are able to interact with RNA molecules. Like hnRNP A1, a nuclear-cytoplasmic shuttle protein, HaABRC5 contains both the TOP-related sequence in its 5'-untranslated region and an NLS. As such, HaABRC5 may have a function similar to that of hnRNP A1 (e.g., regulating translation, possibly through RNA modification, during stress response in sunflower). In rice tungro bacilliform virus, a protein RTBV P2 containing a short basic domain at its C terminal proved to have the capacity to bind both DNA and RNA (Jacquot et al., 1997
). HaABRC5 contains a high percentage of basic amino acid residues and a conserved basic domain (domain-3) at its C terminal. Therefore, it will be worthwhile to investigate whether HaABRC5 has DNA/RNA-binding activity.
In searching available databases with either the complete DNA or deduced amino acid sequence, HaABRC5 had homology only to a few genes from Arabidopsis (Fig. 3). As three conserved domains were identified in HaABRC5, these conserved amino acid sequences also were used to search ESTs (expressed sequence tags) from the databases. A number of partial cDNA sequences encoded amino acid sequences similar to these domains (Fig. 7). Interestingly, all of these cDNAs are from plants (Fig. 7). Furthermore, the Leu residues in domain 1 (Leu-rich domain), the basic amino acid residues of domain 2 (nuclear targeting signal) and domain 3 (C terminal basic domain) are conserved in all EST sequences aligned. These observations imply that not only are these domains conserved, but also they are very likely to be unique to plant proteins. Therefore, we suggest that HaABRC5 is a plant-specific gene encoding a novel nuclear protein.
|
| FOOTNOTES |
|---|
| LITERATURE CITED |
|---|
|
|
|---|
Baker S. S. K. S. Wilhelm M. F. Thomashow 1994 The 5'-region of Arabidopsis thaliana cor15a has cis-acting elements that confer cold-, drought- and ABA-regulated gene expression. Plant Molecular Biology 24: 701-713[CrossRef][Web of Science][Medline]
Bohnert H. J. et al 2001 A genomics approach towards salt stress tolerance. Plant Physiology and Biochemistry 39: 295-311[CrossRef][Web of Science]
Bonham-Smith P. C. T. L. Oancia M. M. Moloney 1992 Cytoplasmic ribosomal protein S15a from Brassica napus: molecular cloning and developmental expression in mitotically active tissues. Plant Molecular Biology 18: 909-919[CrossRef][Web of Science][Medline]
Bray E. 1993 Molecular responses to water deficit. Plant Physiology 103: 1035-1040[Web of Science][Medline]
Busk P. K. M. Pages 1998 Regulation of abscisic acid-induced transcription. Plant Molecular Biology 37: 425-435[CrossRef][Web of Science][Medline]
Camacho-Vanegas O. F. Weighardt C. Ghigna F. Amaldi S. Riva G. Biamonti 1997 Growth-dependent and growth-independent translation of messengers for heterogeneous nuclear ribonucleoproteins. Nucleic Acids Research 25: 3950-3954
Debouck C. 1995 Differential display or differential dismay?. Current Opinion in Biotechnology 6: 597-599
Dingwall C. R. A. Laskey 1991 Nuclear targeting sequencesa consensus?. Trends in Biochemical Sciences 16: 478-481[CrossRef][Web of Science][Medline]
Giuliano G. E. Pichersky V. S. Malik M. P. Timko P. A. Scolnik A. R. Cashmore 1988 An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene. Proceedings of the National Academy of Sciences, USA 85: 7089-7093
Guiltinan M. J. W. R. Marcotte R. S. Quartrano 1990 A plant leucine zipper protein that recognizes an abscisic acid response element. Science 250: 267-270
Ingram J. D. Bartels 1996 The molecular basis of dehydration tolerance plants. Annual Review of Plant Physiology and Plant Molecular Biology 47: 377-403[CrossRef][Web of Science][Medline]
Jacquot E. M. Keller P. Yot 1997 A short basic domain supports a nucleic acid-binding activity in the rice tungro bacilliform virus open reading frame 2 product. Virology 239: 352-359[CrossRef][Web of Science][Medline]
Kawasaki S. C. Borchert M. Deyholos H. Wang S. Brazille K. Kawai D. Galbraith H. J. Bohnert 2001 Gene expression profiles during the initial phase of salt stress in rice. Plant Cell 13: 889-905
Liang P. A. B. Pardee 1992 Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257: 967-971
Liu X. N. 2002 Cloning and characterization of drought-/salinity-responsive genes from sunflower. Ph.D. dissertation (Disssertation Abstracts number ATT 3045216), Clemson University, Clemson, South Carolina, USA
Liu X. N. W. V. Baird 2001 Rapid amplification of genomic DNA ends by NlaIII partial digestion and polynucleotide tailing. Plant Molecular Biology Reporter 19: 261-267[Web of Science]
Liu X. N. W. V. Baird 2003 Differential expression of genes regulated in response to drought or salinity stress in sunflower. Crop Science 43: 678-687
Meyuhas O. D. Avni S. Shama 1996 Translational control of ribosomal protein mRNAs in eukaryotes. In J. W. B. Hershey, M. B. Mathews, and N. Sonneberg [eds.], Translational control, 363388. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA
Moons A. E. Prinsen G. Bauw M. Van Montagu 1997 Antagonistic effects of abscisic acid and jasmonates on salt stress-inducible transcripts in rice roots. Plant Cell 9: 2243-2259[Abstract]
Ramani S. S. K. Apte 1997 Transient expression of multiple genes in salinity-stress young seedlings of rice (Oryza sativa L.) cv. bura rata. Biochemical and Biophysical Research Communications 233: 663-667[CrossRef][Web of Science][Medline]
Razik M. A. R. S. Quatrano 1997 Effect of the nuclear factors EmBP1 and viviparous1 on the transcription of the Em gene in HeLa nuclear extracts. Plant Cell 9: 1791-1803[Abstract]
Romo S. E. Labrador B. Dopico 2001 Water stress-regulated gene expression in Cicer arietinum seedlings and plants. Plant Physiology and Biochemistry 39: 1017-1026[CrossRef][Web of Science]
Sambrook J. E. F. Fritch T. Maniatis 1989 Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA
Sauter A. W. J. Davies W. Hartung 2001 The long-distance abscisic acid signal in the droughted plant: the fate of the hormone on its way from root to shoot. Journal of Experimental Botany 52: 1991-1997
Scharf K.-D. M. Siddique E. Vierling 2001 The expanding family of Arabidopsis thaliana small heat stress proteins and a new family of proteins containing
-crystallin domains (Acd proteins). Cell Stress and Chaperones 6: 225-237[Web of Science][Medline]
Seki M. M. Narusaka H. Abe M. Kasuga K. Yamaguchi-Shinozaki P. Carninci Y. Hayashizaki K. Shinozaki 2001 Monitoring the expression pattern of 1300 Arabidopsis genes under drought and cold stresses by using a full-length cDNA microarray. Plant Cell 13: 61-72
Skriver K. F. L. Olsen J. Roger J. Mundy 1991 Cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid. Proceedings of the National Academy of Sciences, USA 88: 7266-7270
Tabaeizadeh Z. 1998 Drought-induced responses in plant cells. International Review of Cytology 182: 193-247[Web of Science][Medline]
Vasil V. W. R. Marcotte Jr. L. Rosenkrans S. M. Cocciolone I. K. Vasil R. S. Quatrano D. R. McCarty 1995 Overlap of Viviparous1 (VP1) and abscisic acid response elements in the Em promoter: G-box elements are sufficient but not necessary for VP1 transactivation. Plant Cell 7: 1511-1518[Abstract]
Yamaguchi-Shinozaki K. K. Shinozaki 1994 A novel cis-acting element in an Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high-salt stress. Plant Cell 6: 251-264[Abstract]
Zeevaart J. A. D. R. A. Creelman 1988 Metabolism and physiology of abscisic acid. Annual Review of Plant Physiology and Plant Molecular Biology 39: 439-473[CrossRef][Web of Science]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Facebook
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
C. Edelist, X. Raffoux, M. Falque, C. Dillmann, D. Sicard, L. H. Rieseberg, and S. Karrenberg Differential expression of candidate salt-tolerance genes in the halophyte Helianthus paradoxus and its glycophyte progenitors H. annuus and H. petiolaris (Asteraceae) Am. J. Botany, October 1, 2009; 96(10): 1830 - 1838. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Guo, M. Baum, S. Grando, S. Ceccarelli, G. Bai, R. Li, M. von Korff, R. K. Varshney, A. Graner, and J. Valkoun Differentially expressed genes between drought-tolerant and drought-sensitive barley genotypes in response to drought stress during the reproductive stage J. Exp. Bot., August 1, 2009; 60(12): 3531 - 3544. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |