Am. J. Bot.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, X.
Right arrow Articles by Baird, W. V.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Liu, X.
Right arrow Articles by Baird, W. V.
Agricola
Right arrow Articles by Liu, X.
Right arrow Articles by Baird, W. V.
(American Journal of Botany. 2003;90:526-531.)
© 2003 Botanical Society of America, Inc.


Genetics and Molecular Biology

The ribosomal small-subunit protein S28 gene from Helianthus annuus (Asteraceae) is down-regulated in response to drought, high salinity, and abscisic acid1

Xianan Liu2,3 and W. Vance Baird4,5

2Department of Horticulture and Genetics Graduate Program, Clemson University, Clemson, South Carolina 29634-0375 USA; 3Department of Plant Biology, 190 ERML, University of Illinois, Urbana, Illinois 61801 USA; 4Department of Horticulture, D-136 Poole Agriculture Center, Box 340375, Clemson University, Clemson, South Carolina 29634-0375 USA

Received for publication July 11, 2002. Accepted for publication November 8, 2002.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
A partial cDNA for the ribosomal S28 gene from sunflower was initially cloned and identified to be down-regulated by high salinity, using differential display reverse transcriptase-polymerase chain reaction (PCR). Using this sequence, a 502-base pair (bp) full-length cDNA was cloned by rapid amplification of cDNA ends. This cDNA (designated Ha-RPS28) encodes a protein component of the small subunit of cytoplasmic ribosomes. The predicted 65 amino acid residue sequence of Ha-RPS28, with an estimated molecular mass of 7.5 kD, has 92, 89, and 86% identity with the S28 ribosomal proteins from peach, maize, and Arabidopsis, respectively. Ha-RPS28 was expressed in all organs examined, and the highest level was detected in fully expanded leaves. Furthermore, expression of Ha-RPS28 was down-regulated in both seedling roots and shoots in response to drought, high salinity, or abscisic acid.

Key Words: abiotic stress • Asteraceae; cDNA cloning • environmental stress • gene expression • gene regulation • ribosomal protein • sunflower


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Ribosomes are small, complex, non-membrane-bound organelles that catalyze peptide bond formation during protein synthesis in all living organisms. There are approximately 80 ribosomal proteins (Barakat et al., 2001 ) that represent approximately 10% by mass of the total cellular proteins (Giannino et al., 2000 ). In both Escherichia coli and Saccharomyces cerevisiae, biosynthesis of ribosomal proteins (r-proteins) is coordinately regulated, and related to the rate of ribosome formation (reviewed by Nomuma, 1999). In plants, r-protein biosynthesis has been suggested to be regulated at the post-transcriptional (Giannino et al., 2000 ) or the translational levels (Beltran-Pena et al., 1995 ). In a variety of plant species, the genes encoding r-proteins are highly expressed in actively dividing tissues (Larkin et al., 1989 ; Bonham-Smith et al., 1992 ; Van Lijsebettens et al., 1994 ; Turley et al., 1995 ; Giannino et al., 2000 ).

In addition to protein synthesis, r-proteins were reported to have extra-ribosomal functions (Wool, 1996 ). Very few studies deal with the regulation of expression of r-protein genes. For example: expression of the small subunit r-protein S26 is down-regulated by ultraviolet-B radiation in pea (Brosche and Strid, 1999 ); in soybean, expression of the large subunit r-protein L2 gene is transiently down-regulated in response to pathogen infection (Ludwig and Tenhaken, 2001 ); and differential expression of r-protein S1 in response to heat, oxidative, and acid stresses was observed in Brucella melitensis (Teixeira-Gomes et al., 2000 ). In plants, little is known about the regulation of expression of other r-protein genes, especially their regulation in response to environmental stress.

To date, genes that encode the S28 protein of the small ribosomal subunit (RPS28) have been cloned from only three plant species: Arabidopsis (P34789, Hwang and Goodman, 1993 ), peach (CAA10104 Giannino et al., 2000 ), and maize (P46302). The expression pattern of RPS28 was analyzed only in peach (Giannino et al., 2000 ). That investigation focused on regulation of PRS28 during development of young and late-stage tissues; its regulation in response to any abiotic/environmental stress was not studied. We report the cloning and sequencing of the full-length cDNA of an RPS28 gene from sunflower and provide data regarding its expression pattern in response to drought, high salinity, and exogenously applied abscisic acid (ABA).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Plant material and growth conditions
Sunflower plants of the genotype Triumph 545 (Triumph Seed, Ralls, Texas, USA) were grown from seed in the greenhouse under 16 h of light (250 µE · m–2 · s–1 minimum), ambient day/night temperature and 60–80% humidity. One-week-old seedlings were transferred to PeatLite composite soil (peat compost/vermiculite, 1 : 1, Piedmont Farm and Nursery Supply, Spartanburg, South Carolina, USA), watered daily with tap water, and fertilized weekly with 1 : 250 Peters soluble fertilizer (20–10–20, Piedmont Farm and Nursery Supply). Roots and leaves of 1-mo-old plants were collected for RNA extraction. Each experiment had three replicates, and the experiments were repeated at least twice.

For drought treatment, 1-wk-old seedlings were stressed by air drying for 10 h. Control seedlings were transferred to a beaker of water. Roots and shoots were collected separately for RNA extraction.

For high salinity treatment, 1-wk-old seedlings were transferred to a beaker containing 250 mmol/L NaCl solution for 6 h. Control seedlings were also transferred to a beaker containing water for 6 h. Roots and shoots from stressed and control seedlings were collected separately for RNA extraction. The water content (as estimated by comparisons of dry mass measurements) decreased 10% after air drying seedlings or after treating seedlings in the 250 mmol/L NaCl solution.

For ABA treatment, 1-wk-old seedlings were transferred to a container of 100 µmol/L ABA solution (mixed isomers, ± cis/trans, Sigma, St. Louis, Missouri, USA) for 24 h. Control seedlings were transferred to water. Roots and shoots from stressed and control seedlings were collected separately for RNA extraction.

Cloning and sequencing
Total RNA was isolated from 1-g tissue samples using an RNAqueous Kit (Ambion, Austin, Texas, USA). DNA contamination was removed using a MessageClean Kit (GenHunter, Nashville, Tennessee, USA). Using differential display reverse transcriptase-polymerase chain reaction (DDRT-PCR), a 180-base pair (bp) cDNA fragment (designated RSG22-D) was isolated from salinity-stressed seedling roots (Liu and Baird, 2003 ). The 5' end sequence of the full-length sunflower cDNA (designated Ha-RPS28) was cloned by RACE using the GeneRacer kit (Invitrogen, Carlsbad, California, USA). Because a poly(dT) primer was used for DDRT-PCR only 5'-RACE was performed. The two gene-specific primers (GSP1: TCACCCACCCATCAAACATACTCC; and GSP2: AACCCAAACCTGCTACTAGGATCAA) used for RACE were based on the sequence of RSG22-D (GenBank accession number: BG734530). The RACE products were cloned into the pGEM-T easy vector (Promega, Madison, Wisconsin, USA) and the inserts were sequenced on an ABI (Perkin Elmer, Branchburg, New Jersey, USA) model 373 automated DNA sequencer, using T7 and SP6 primers and the Prism Dye Terminator kit (ABI), following protocols recommended by the manufacturer.

Quantitative RT-PCR
The expression pattern of Ha-RPS28 was analyzed by quantitative RT-PCR. The primer pair for amplification of plant 18S rRNA (the internal standard) and the 18S rRNA inhibitory competitive primer pair were from a QuantumRNA kit (Ambion). Each RT reaction contained 5 mmol/L KCl, 10 mmol/L Tris-HCl (pH 8.3), 4 mmol/L MgCl2, 25 µmol/L of each dNTP, 0.2 µmol/L random hexamers (Promega), 1 µg total RNA, and 100 units (U) MMLV reverse transcriptase (GenHunter). For each PCR reaction, 1/10 (volume) of the cDNA was added in a cocktail containing 100 µmol/L of each dNTP, 0.2 µL of {alpha}-32P-dCTP, 1 µmol/L of each Ha-RPS28 gene-specific primer pair (i.e., RSG22-DRT5': TTTGATCCTAGTAGCAGGTTTGGGT; and RSG22-DRT3': GACAAAAACTGATTTGTTCACATGGAT), 1 µmol/L of 18S rRNA primer pair and 18S rRNA inhibitory primer pair mixture (1 : 9), 0.5 U of Taq DNA polymerase (Promega) with its own buffer containing 1.5 mmol/L MgCl2. After denaturation at 95°C for 3 min, 20 PCR cycles (95°C for 30 s, 60°C for 30 s, and 72°C for 30 s) were performed, followed by a 1-min extension step at 72°C. One-fifth (volume) of the PCR product was analyzed on a 6% denaturing acrylamide gel.

The same protocol was also used to analyze the expression of the sunflower gene encoding the large ribosomal-subunit protein L41 (designated Ha-RPL41) (Liu and Baird, 2003 ), except that a different gene-specific primer pair (CAp1-2RT5': CGGGTGTTGTGACACATGCTTGCAGCC; and CAp1-2RT3': CATCCAACACAGTAATACCATTTCC) was used for these amplifications.

Each quantitative RT-PCR experiment was performed at least twice to confirm results. The intensity of each quantitative RT-PCR product was determined by scanning densitometry. Scanning and integration were performed using a Fuji Image System (Fujifilm, Duluth, Georgia, USA). All quantitative RT-PCR amplified DNA fragments were sequenced (as described before) to confirm their identities.

Southern blot analysis
Total DNA was isolated from seedlings (2 g tissue) using a Nucleon Phytopure Plant DNA Extraction kit (Amersham, Piscataway, New Jersey, USA). The purified DNA was then digested to completion using the restriction enzyme BamH I or Hind III. The digested DNA (10 µg) was size fractionated in 1% agarose gels and transferred onto Hybond N+ membrane (Amersham) in 5x SSPE (0.9 mol/L NaCl, 50 mmol/L sodium phosphate, pH 7.7, and 0.5 mmol/L EDTA) containing 0.4 mol/L NaOH. The membrane was renatured in neutralization buffer (1 mol/L Tris, pH 7.4 and 1.5 mol/L NaCl) for 5 min, and the DNA cross-linked to the membrane with UV light. The full length Ha-RPS28 cDNA was radiolabeled by PCR using the primers RSG22-start: ATTCTCTTGCAGAAGCTTCAACGA; and RSG22-end: GGACAAAAACTGATTTGTTCACAT. PCR amplification was performed in a 50-µL reaction volume containing 10 ng Ha-RPS28 cDNA, 100 nmol/L of each primers, 2 µL of {alpha}-33P-dCTP (NEN), 2 µmol/L each dNTP, and 5 U of Taq polymerase (Promega). A program of 15 cycles of 30 s denaturation at 95°C, 30 s annealing at 60°C, and 90 s extension at 72°C was used. The labeled probe was column purified (BioRad, Hercules, California, USA). Hybridization and washes followed standard methods for high stringency (Sambrook et al., 1989 ).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Characterization of Ha-RPS28
The sequence of Ha-RPS28 cDNA was 502 bp in length and contained an open reading frame of 195 bp coding for a protein of 65 amino acids (Fig. 1). The length of the protein coding sequence is the same as the RPS28 cDNAs from maize and peach, and it is one amino acid longer than the RPS28 cDNA from Arabidopsis (Fig. 2). The predicted molecular mass of Ha-RPS28 is 7.5 kD and has an estimated isoelectric point (pI) of 11.1. The cDNA has a 5' untranslated region (UTR) of 67 nucleotides (nt) and a 3' UTR of 240 nt. As with the cDNA from peach (Giannino et al., 2000 ), the 5' UTR of Ha-RPS28 harbored a short pyrimidine tract (i.e., terminal oligo pyrimidine, TOP) at the very 5' end of the transcript (Fig. 1A). The TOP genes, some of which encode r-proteins, may be regulated at the transcriptional level in a growth-dependent manner (Meyuhas et al., 1996 ; Amaldi and Pierandrei-Amaldi, 1997 ). Similar to the RPS28 gene from peach, the 3' UTR of Ha-RPS28 also lacked a canonical polyadenylation tract. Therefore, the sequence AATAT (nt 472–476, Fig. 1A) is likely to be the functional polyadenylation signal (Bonham-Smith et al., 1992 ).



View larger version (48K):
[in this window]
[in a new window]
 
Fig. 1. Nucleotide sequence and deduced amino acid sequence of Ha-RPS28 cDNA and protein, respectively. The predicted ATG initiation and TGA stop codons are in bold typeface; 5' terminal oligo pyrimidine (TOP) tract is in lowercase italic typeface (1–8); two adenylate/uridylate-rich elements (AREs) are in bold italic typeface (423–427; 441–445), and the putative polyadenylation signal is shown in lowercase bold typeface (472–476)

 


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. Ha-RPS28 amino acid sequence in alignment with S28 r-protein sequence of peach (Pp-RPS28), maize (Zm-RPS28), and Arabidopsis (At-RPS28). Identical amino acids appear in black boxes, similar amino acids appear in gray boxes, and differences appear in white boxes

 
Interestingly, two adenylate/uridylate-rich elements (AREs) were observed in the 3' UTR of Ha-RPS28 mRNA (nt 423–427 and 440–444, Fig. 1). The AUUUA repeats function in mRNA degradation during post-transcriptional regulation of gene expression (Chen and Shyu, 1995 ). The mRNA decay pathway mediated by AREs has been analyzed in only a few plant species (Ohme-Takagi et al., 1993 ). The presence of the two AREs in Ha-RPS28 is intriguing because, to date, no r-protein gene mRNA has been reported to be regulated under the control of AREs.

As shown in Fig. 2, Ha-RPS28 shares high homology to the known sequences of RPS28 from three other plant species. The predicted RPS28 amino acid sequence of sunflower has 92, 89, and 87% identities to the RPS28 proteins from peach, maize, and Arabidopsis, respectively.

To determine the organization of Ha-RPS28 and related sequences in the sunflower genome, DNA gel blot (Southern) analysis was performed. Genomic DNA from sunflower was digested with an endonuclease (EcoRI or HindIII), size fractionated and hybridized with radiolabeled Ha-RPS28 cDNA probe. Three hybridizing restriction fragments (i.e., EcoRI generated 2.2-, 3.3-, and 5.2-kilobase [kb] fragments; HindIII generated 2.7-, 4.6-, and 8-kb fragments) were observed from the genomic DNA digested with each enzyme (Fig. 3). These results suggest that Ha-RPS28 is organized in a small gene family. Considering fragment number, fragment size, and hybridization signal intensities there are no more than four, and probably only three, members of the RPS28 gene family in the sunflower genome.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 3. Southern blot analysis of Ha-RPS28 gene. Genomic DNA was digested with EcoRI (E) or HindIII (H) and hybridized with radiolabeled Ha-RPS28 cDNA. M = molecular size marker (1-kb-Plus DNA ladder; Life Technologies, Rockville, Maryland, USA)

 
General expression pattern of Ha-RPS28
As shown in Fig. 4, Ha-RPS28 is expressed at the highest level in mature leaves of 1-mo-old plants. The transcript level in leaves was approximately 1.5- to 1.8-fold greater than that present in mature roots of 1-mo-old plants and roots or shoots of seedlings (Fig. 4). Overall, Ha-RPS28 exhibited an expression pattern basically the same as that reported for peach RPS28, where it is expressed more in leaves than in roots (Giannino et al., 2000 ).



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 4. Expression of Ha-RPS28 in roots (SR) and shoots (SS) of 1-wk-old seedlings, and roots (R) and leaves (L) of 1-mo-old plants (means ± 1 SE). *The expression level for each sample was determined by its signal intensity relative to that of 18S rRNA gene; the highest expression level in leaves was used as the value of comparison (100%)

 
The expression of RPS28 in peach was reported to be regulated at the post-transcriptional level. The pre-mRNA (hnRNA) of peach RPS28 was detected in several late-stage tissues (e.g., those that show intense metabolic rather than mitotic activity), such as late-stage leaves and stems (Giannino et al., 2000 ). To investigate the presence of pre-mRNA in sunflower, cDNAs from total RNA of seedling roots and shoots were PCR amplified with four different primer-pair combinations, which completely cover the Ha-RPS28-coding region (and thus should span any unprocessed introns). Only a single (identical) product was amplified in each case for each primer combination, including the pair that spanned the entire cDNA (data not shown). Thus, consistent with the finding in peach, Ha-RPS28 pre-mRNA was not observed in the "young" organs examined. However, unlike peach, no pre-mRNA was detected in late-stage tissue of sunflower (i.e., fully expanded leaves).

Expression of Ha-RPS28 is down-regulated following exposure to drought, high salinity, or ABA
To analyze the response of Ha-RPS28 expression to different environmental stress stimuli or signals, 1-wk-old seedlings were stressed with drought, or 250 mmol/L NaCl, or 100 µmol/L ABA. From preliminary DDRT-PCR, expression of Ha-RPS28 was down-regulated in seedling roots but not in shoots when treated with high salinity (Liu and Baird, 2003 ). However, the expression of Ha-RPS28 was found to be down-regulated in both seedling roots and shoots in response to high salinity when analyzed by quantitative RT-PCR (Fig. 5A). This discrepancy is probably due to the limitations of the DDRT-PCR method, such as the indiscriminant amplification of a population of similarly sized cDNAs that include the differentially expressed sequence as well as constitutively expressed sequences (Debouck, 1995 ).



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 5. Expression pattern of Ha-RPS28 (A) and Ha-RPL41 (B) in roots and shoots of sunflower seedlings in response to salinity, drought, or abscisic acid (ABA) (means ± 1 SE). The cDNAs were synthesized from total RNAs isolated from roots of control seedlings (RC) and shoots of control seedlings (SC), seedling roots (RS) and shoots (SS) treated with 250 mmol/L NaCl, seedling roots (RD) and shoots (SD) stressed by drought, and seedling roots (RA) and shoots (SA) treated with ABA. *The expression level for each sample was determined by its signal intensity relative to that of the 18S rRNA gene; the expression levels of control seedling roots and shoots were used for quantifying gene expression in stressed seedling roots and shoots, respectively

 
Expression of Ha-RPS28 in salt-treated seedling shoots and roots was reduced by 40% and 72% of that observed in control seedling shoots and roots, respectively (Fig. 5A). Down-regulation of Ha-RPS28 expression by drought was also observed in seedling shoots and roots. The transcript levels of Ha-RPS28 in drought-treated seedling shoots and roots were reduced by 30% and 70% of those measured in control samples, respectively (Fig. 5A). Furthermore, when treated with exogenous ABA, Ha-RPS28 was expressed at lower levels in treated seedling shoots and roots (reduced by approximately 30% and 40% of those in control samples, respectively; Fig. 5A); however, the effect of ABA on regulation of Ha-RPS28 gene expression, especially for shoots, is not as great as is high salinity or drought. As shown in Fig. 5A, in general, sunflower roots respond to high salinity, drought, and exogenous ABA to a greater extent than do the shoots. The greater response may be in part due to the fact that the stress-associated hormone ABA is synthesized only in roots and that roots in many instances are the first organs to encounter stress that affects plant water status (Sauter et al., 2001 ).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
High expression of r-protein genes in plants occurs in actively dividing tissues (Larkin et al., 1989 ; Bonham-Smith et al., 1992 ; Van Lijsebettens et al., 1994 ; Turley et al., 1995 ; Giannino et al., 2000 ). Also, salinity stress has been shown to inhibit cell division in e.g., rice (Samarajeewa et al., 1999 ) and jojoba (Burgos et al., 1993 ). In sunflower in particular, both drought stress and ABA treatment inhibit DNA synthesis and mitotic activity (Robertson et al., 1990 ). These results coupled with our data suggest that the decrease in Ha-RPS28 expression in different organs of sunflower is linked to the general reduction in mitotic activity as a consequence of exposure to abiotic stress (i.e., drought or salt).

In peach, regulation of the expression of RPS28 is suggested to be controlled at the level of precursor RNA splicing, because premature (unprocessed) mRNA was detected in late-stage tissues (Giannino et al., 2000 ). However, in sunflower, we did not detect premature Ha-RPS28 mRNA in control seedlings or in seedlings exposed to drought, high salinity, or ABA (data not shown). Therefore, our results suggest that expression of Ha-RPS28 in response to environmental stress is probably regulated at the transcriptional level in sunflower. In addition, because ARE repeats were present in the 3' UTR of Ha-RPS28 mRNA, the low levels of transcript detected in stressed organs may be a consequence of ARE-directed mRNA degradation at the post-transcriptional stage. However, the functioning of a plant ARE-mediated decay pathway is poorly understood at this time.

Another r-protein cDNA, which encodes RPL41, was also cloned from sunflower (CAp1-2U, GenBank access number: BG734516; Liu and Baird, 2003 ). Expression of this sunflower gene, Ha-RPL41, was also analyzed by quantitative RT-PCR. Ha-RPL41 was expressed almost equally in all organs tested, and its expression was not regulated by drought, high salinity, or ABA (Fig. 5B). This result suggests that different mechanisms are likely to be involved in regulating overall r-protein gene expression at the transcriptional level. In fact, differential expression of r-protein genes has been observed in several plant species (Bonham-Smith et al., 1992 ; Stafstrom and Sussex, 1992 ; Garo et al., 1994 ; Lenvik et al., 1994 ; Turley et al., 1995 ; William and Sussex, 1995 ). Recently, all r-protein genes were characterized from genomic DNA and expressed sequence tag (EST) sequences of Arabidopsis (Barakat et al., 2001 ). Analysis of the frequency of ESTs for individual r-protein genes suggests that these genes are expressed differentially among the different members of a gene family, as well as between different gene families (Barakat et al., 2001 ). Overall, the biosynthesis of r-proteins must be regulated at many different levels (e.g., transcriptional, post-transcriptional, and translational) if their expression is to be coordinated with the formation of ribosomes during different developmental stages and under the different physiological environments experienced by plant cells.


    FOOTNOTES
 
1 The authors thank Triumph Seed Company for the donated plant material and Ms. Rebecca Ackerman of the Clemson University DNA sequencing facility for her assistance with DNA sequencing. This work was supported by the South Carolina Agriculture Experiment Station (SCAES) and a grant from U.S.-A.I.D. University Linkages Project II (93/01/35; 263-0211) to WVB. This article is technical contribution number 4827 of the SCAES, Clemson University. Back

5 Author for reprint requests (phone: 864-656-4953; FAX: 864-656-4960; vbaird{at}clemson.edu ) Back


    LITERATURE CITED
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 LITERATURE CITED
 
Amaldi F. P. Pierandrei-Amaldi 1997 TOP genes: a translationally controlled class of genes including those coding for ribosomal proteins. In P. Jeanteur [ed.], Cytoplasmic fate of eukaryotic mRNA, 1–17. Springer-Verlag, Heidelberg, Germany

Barakat A. K. Szick-Miranda I. F. Chang R. Guyot G. Blanc R. Cooke M. Delseny J. Bailey-Serres 2001 The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. Plant Physiology 127: 398-415[Abstract/Free Full Text]

Beltran-Pena E. A. Ortiz-Lopez E. Sanchez de Jimenez 1995 Synthesis of ribosomal proteins from stored mRNAs early in seed germination. Plant Molecular Biology 28: 327-336[CrossRef][Web of Science][Medline]

Bonham-Smith P. C. T. L. Oancia M. M. Moloney 1992 Cytoplasmic ribosomal protein S15a from Brassica napus: molecular cloning and developmental expression in mitotically active tissues. Plant Molecular Biology 18: 909-919[CrossRef][Web of Science][Medline]

Brosche M. A. Strid 1999 The mRNA-binding ribosomal protein S26 as a molecular marker in plants: molecular cloning, sequencing and differential gene expression during environmental stress. Biochimica et Biophysica Acta 1445: 342-344[Medline]

Burgos P. A. M. Roldan I. Agui J. P. Donaire 1993 Effect of sodium chloride on growth, ion content, and hydrogen ion extrusion activity of sunflower and jojoba roots. Journal of Plant Nutrition 16: 1047-1058[Web of Science]

Chen C.-Y. A. A.-B. Shyu 1995 AU-rich elements: characterization and importance in mRNA degradation. Trends in Biochemical Sciences 20: 465-470[CrossRef][Web of Science][Medline]

Debouck C. 1995 Differential display or differential dismay?. Current Opinion in Biotechnology 6: 597-599

Garo J. S. R. Kim Y. Y. Chung J. M. Lee G. An 1994 Developmental and environmental regulation of two ribosomal protein genes in tobacco. Plant Molecular Biology 25: 761-770[CrossRef][Web of Science][Medline]

Giannino D. G. Frugis C. Ticconi S. Florio G. Mele L. Santini R. Cozza B. Bitonti A. Innocenti D. Mariotti 2000 Isolation and molecular characterization of the gene encoding the cytoplasmic ribosomal protein S28 in Prunus persica [L.] Batsch. Molecular and General Genetics 263: 201-212

Hwang I. H. M. Goodman 1993 Cloning of an Arabidopsis ribosomal protein S28 cDNA. Plant Physiology 102: 1357-1358[CrossRef][Web of Science][Medline]

Larkin J. C. J. P. Hunsperger D. Culley I. Rubenstein C. D. Silflow 1989 The organization and expression of a maize ribosomal protein family. Genes and Development 3: 500-509[Abstract/Free Full Text]

Lenvik T. R. J. L. Key J. S. Gantt 1994 Ribosomal protein S11 genes from Arabidopsis and soybean. Plant Physiology 105: 1027-1028[CrossRef][Web of Science][Medline]

Liu X. W. V. Baird 2003 Differential expression of genes regulated in response to drought- or salinity-stress from Helianthus annuus L. (sunflower). Crop Science 43: 678-687[Abstract/Free Full Text]

Ludwig A. R. Tenhaken 2001 Suppression of the ribosomal L2 gene reveals a novel mechanism for stress adaptation in soybean. Planta 212: 792-798[CrossRef][Web of Science][Medline]

Meyuhas O. D. Avni S. Shama 1996 Translational control of ribosomal protein mRNAs in eukaryotes. In J. W. B. Hershey, M. B. Mathews, and N. Sonneberg [eds.], Translational control, 363–388. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA

Noroma M. 1999 Regulation of biosynthesis in Escherichia coli and Saccharomyces cerevisiae: diversity and common principles. Journal of Bacteriology 181: 6857-6864[Free Full Text]

Ohme-Takagi M. C. B. Taylor T. C. Newman P. J. Green 1993 The effect of sequences with high AU content on mRNA stability in tobacco. Proceedings of the National Academy of Sciences, USA 90: 11811-11815[Abstract/Free Full Text]

Robertson J. M. E. C. Yeung D. M. Reid K. T. Hubick 1990 Developmental responses to drought and abscisic acid in sunflower roots. 2. Mitotic activity. Journal of Experimental Botany 41: 339-350[Abstract/Free Full Text]

Samarajeewa P. K. R. A. Barrero C. Umeda-Hara M. Kawai H. Uchimiya 1999 Cortical cell death, cell proliferation, macromolecular movements and rTip1 expression pattern in roots of rice (Oryza sativa L.) under NaCl stress. Planta 207: 354-361[CrossRef][Web of Science]

Sambrook J. E. F. Fritch T. Maniatis 1989 Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA

Sauter A. W. J. Davies W. Hartung 2001 The long-distance abscisic acid signal in the droughted plant: the fate of the hormone on its way from root to shoot. Journal of Experimental Botany 52: 1991-1997[Abstract/Free Full Text]

Stafstrom J. P. I. M. Sussex 1992 Expression of a ribosomal protein gene in axillary buds of pea seedlings. Plant Physiology 100: 1494-1502[Abstract/Free Full Text]

Teixeira-Gomes A. P. A. Cloeckaert M. S. Zygmunt 2000 Characterization of heat, oxidative, and acid stress responses in Brucella melitensis. Infection and Immunity 68: 2954-2961[Abstract/Free Full Text]

Turley R. B. D. L. Ferguson W. R. Meredith Jr 1995 A cDNA encoding ribosomal protein S4e from cotton (Gossypium hirsutum L). Plant Physiology 108: 431-432[CrossRef][Web of Science][Medline]

Van Lijsebettens M. R. Vanderhaeghen M. de Block G. Bauw R. Villarroel M. Van Montagu 1994 An S18 ribosomal protein gene copy at the Arabidopsis PFL locus affects plant development by its specific expression in meristems. European Molecular Biology Organization Journal 13: 3378-3388

Williams M. E. I. M. Sussex 1995 Developmental regulation of ribosomal protein L16 genes in Arabidopsis thaliana. Plant Journal 8: 65-76[CrossRef][Web of Science][Medline]

Wool I. G. 1996 Extraribosomal functions of ribosomal proteins. Trends in Biochemistry 21: 164-165[CrossRef]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, X.
Right arrow Articles by Baird, W. V.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Liu, X.
Right arrow Articles by Baird, W. V.
Agricola
Right arrow Articles by Liu, X.
Right arrow Articles by Baird, W. V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS