| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Systematics |
2Department of Biochemistry, University of Stellenbosch, Stellenbosch, Private Bag X1, Matieland 7602, South Africa; 3Bolus Herbarium, University of Cape Town, Rondebosch 7700, South Africa; and 4Department of Chemical Pathology, University of Cape Town Medical School, Mowbray 7925, South Africa
Received for publication December 8, 2000. Accepted for publication April 6, 2001.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Key Words: Brownleeinae • Coryciinae • Diseae • Disinae • molecular phylogeny • Orchidaceae • Satyriinae • trnL-trnF
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
). Diseae encompasses 54% of all orchids endemic to southern Africa, underlining its importance in the local orchid flora. Linder and Kurzweil (1994)
recognize five subtribes in the tribe. Of these, Huttonaeinae and Brownleeinae each contain a single genus. Douzery et al. (1999)
corroborated the monophyly of the subtribes with the exception of the Coryciinae, which may be diphyletic, and suggested that the tribe itself may be paraphyletic, with Orchideae embedded in Diseae. Almost half of all species in the Diseae belong to the subtribe Disinae. The subtribe was revised taxonomically by Linder in 1981, resulting in a complicated taxonomy of five genera, and many subgenera, sections, and series. However, attempts to establish a well-resolved phylogeny of the subtribe based on morphological data have been unsuccessful (Linder, 1986
; Linder and Kurzweil, 1990
). Recent morphological work suggested that Brownleea should be excluded from the subtribe, and that Monadenia and Herschelianthe should be included in Disa, thus reducing the subtribe to two genera: Schizodium with 6 species and Disa with 131 species (Johnson, Linder, and Steiner, 1998
; Linder and Kurzweil, 1999
).
Recently, phylogenetic studies in the Orchidaceae have benefitted greatly from molecular studies. Although the suprageneric relationships in this family based on rbcL sequences have been described (Cameron et al., 1999
), only single representatives of the genera Disa and Satyrium were included in this study. Other studies have sought to define the phylogenetic relationships of the subtribe Orchidinae based on the more heterogenous nuclear ITS sequences, but did not investigate the Disinae in any detail, using only Disa uniflora as an outgroup (Pridgeon et al., 1997
; Bateman, 2001
; Bateman et al., 2001
). Douzery et al. (1999)
sequenced the ITS genes of 13 members of Disa, thereby inferring some relationships within the Disinae.
We have studied the phylogenetic relationships among 41 species of Disa, including some species in the formerly recognized genera Herschelianthe and Monadenia, based on the more variable noncoding trnL intron and trnL-trnF spacer regions in the chloroplast genome. Seven species from the closely related genera Brownleea, Satyrium, and Corycium within the tribe Diseae and five of the more distantly related genus Habenaria within the tribe Orchideae were used as outgroups. These outgroups were found not to root the tree unequivocally and although not qualifying as a close outgroup, Tridactyle bicaudata, a South African species of Epidendroideae, was used to conclusively root the tree. This study was undertaken to establish: (1) whether the trnL intron and trnL-trnF spacer region of cpDNA was of utility for phylogenetic work within Disa; and (2) whether a molecular phylogeny based on these regions would give support to the previously proposed classification based on morphological and molecular characters.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
), but representatives of most other sections were also included (Table 1; classification following on Linder and Kurzweil, 1999
). There are currently two hypotheses on the phylogeny within the Orchidoideae: Linder and Kurzweil (1994)
proposed a monophyletic Diseae, whereas Douzery et al. (1999)
presented evidence for a paraphyletic Diseae. Consequently, we used outgroup species from within the tribe Diseae (two species of Brownleea, three of Satyrium, and two of Corycium), as well as the tribe Orchideae (five species of Habenaria), and Tridactyle bicaudata (Epidendroideae) was used to root the tree.
|
. Initially, the trnL intron and the trnL-trnF spacer region of the chloroplast genome were amplified using the "c" and "d" primers and the "e" and "f" primers (Taberlet et al., 1991
) by polymerase chain reaction (PCR) using standard techniques at a 2.5 mmol/L MgCl2 concentration. In the initial stages of this study, sequences were generated using the method of Sanger (eight taxa), but it was found that the "c" primer consistently gave sequencing problems. As a result, an alternative primer near the 5' end of the trnL intron was designed to recognize the conserved region II (Fangan et al., 1994
) and is referred to as "c2" (GGATAGGTGCAGAGACTCAAT). This primer worked well for amplification as well as for sequencing purposes. As a result, all trnL intron amplifications and sequences were generated using this primer. An ABI Prism 377 sequencer was employed to sequence all other taxa. In order to eliminate possible sequencing technique errors (i.e., Sanger vs. automated), eight taxa were sequenced using both methods. In the later phases of this study, it was established that full length amplification products could be sequenced with the "c" primer using the automated sequencer; full length sequences of Disa uniflora, D. thodei, D. sagittalis, D. venosa, and D. saxicola were generated.
Sequences were aligned using the DNA and Protein Sequence Alignment (DAPSA) program developed by Harley (1998)
. Sequence data were trimmed to eliminate autapomorphic ends, after which they were combined. Sequences from both regions were submitted to GenBank as indicated in Table 1. Character by taxon matrices were generated by DAPSA. Indels were coded as separate characters and quantified according to the method of Giribet and Wheeler (1999)
and assigned a weight of one.
The most parsimonious trees were sought by step-wise addition calculation followed by a tree bisection and reconnection (TBR) process, holding only five trees for each of 500 random taxon entry replicates, as implemented in PAUP* (Swofford, 1993). The resulting set of most parsimonious trees were then entered into a TBR search retaining as many most parsimonious trees as physically possible (i.e., MULPARS on, with no limit set) in order to find all most parsimonious trees. This protocol is designed to avoid islands of parsimony (Maddison, 1991
).Where multiple most parsimonious trees were obtained, the strict consensus tree was calculated. Nodal support was investigated using the bootstrap (BS; Felsenstein, 1985
) using 200 replicates of random taxon selections. For each replicate, ten random taxon entry searches, using TBR, were done, but keeping only ten trees for each replicate. The Bremer support decay index (DI), which is the increase in tree length if a node is lost, was obtained using Auto-Decay (Eriksson and Wikström, 1995
). Branch lengths were obtained for unambiguous optimizations only. In order to search for more resolution, successive approximations weighting (Farris, 1969
) were conducted, with the data weighted a posteriori by the Rescaled Consistency Index (Farris, 1989
). Nodal support was not recalculated for the weighted matrix.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
|
Five species were sampled from two localities and sequenced to assess sequence variation within species (Satyrium longicauda from Mt Thesiger and Mhlahlane, D. tripetaloides from Kwa-Zulu Natal and Western Cape, D. racemosa from Bain's Kloof and Hermanus, D. caulescens from Groot Winterhoek and Rivier Sonder End, and D. maculata from Groot Winterhoek and Silvermine). No variation was found within Satyrium longicauda, D. tripetaloides, and D. racemosa, and so only one sequence of each was included in the data set. In other species, within-species variation was found. However, this variation occurred only in the form of indels; no substitutions were found between different populations of any species. For the purpose of this analysis the sequence from only one sample of each species was used.
The final length of the aligned data set of the trnL intron was 1412 bp and of the trnL-trnF spacer was 359 bp, resulting in a final matrix alignment with a total length of 1771 bp. Of these, 182 were parsimony informative (144 substitutions and 38 indels). The information contained in the data matrix is summarized in Table 2.
|
Disa glandulosa collected from Table Mountain gave two PCR products of different sizes which, when sequenced, gave identical sequences except for a difference in the number of repeats in regions A and B (shown as D. glandulosa 1 and 2, respectively, in Fig. 1). Individual plants possessed either the one or the other repeat pattern: D. glandulosa 1, which has 13 repeats in region A and 12 repeats in region B, or D. glandulosa 2, which has eight repeats in region A and eight repeats in region B. This effectively meant that the PCR product of D. glandulosa 1 is 117 bp larger than D. glandulosa 2. In view of the fact that the sequences of the two haplotypes of D. glandulosa samples differed only in the numbers of repeats, only D. glandulosa 1 was included in the phylogenetic analyses. This was justified as the numbers of repeats in both D. glandulosa 1 and D. glandulosa 2 were autapomorphic and therefore did not contribute parsimony-informative characters to the data matrix.
Phylogenetic trees reconstructed by maximum parsimony
Parsimony search located in excess of 64 000 trees of a length of 372 steps, with a consistency index of 0.628 and a retention index of 0.822. The strict consensus tree lost substantial resolution. Reweighting the characters improved resolution only slightly, indicating that the lack of resolution was due not to character conflict but to numerous zero-length branches on the tree (Fig. 3). The distribution of branch-lengths on the tree was remarkably uneven.
|
Monophyly of the Disinae is strongly supported, with a BS value of 95% and DI of 5. Three clades emerge within the Disinae. The first clade includes two species (D. vaginata and D. glandulosa). The second clade includes 14 species (D. uniflora, D. caulescens, D. venosa, D. racemosa, D. aurata, D. tripetaloides, D. cardinalis, D. rosea, D. bivalvata, D. richardiana, D. atricapilla, D. filicornis, D. tenuifolia, and D. cylindrica).Within this clade are several strongly supported subclades. The first segregate is D. cylindrica, the only species in this clade that has not been classified into sect. Disa. Disa racemosa, D. aurata, D. tripetaloides, D. cardinalis, D. rosea, and D. bivalvata form a strongly supported clade, but with almost no resolution of the relationships among the species within this clade. Disa venosa appears basal to this group. Disa uniflora is placed as sister species to D. caulescens. The remaining species in the clade (D. filicornis, D. richardiana, D. atricapilla, and D. tenuifolia) are basal to the D. uniflora and D. venosa clades, placed with little if any resolution. The third clade in the Disinae is less well supported. Within this clade a number of groupings appear, but many of them only have weak support, and there is substantial loss of resolution in the strict consensus tree. Well-supported clades include the representatives of sect. Phlebidia (D. maculata, D. virginalis, and D. longicornu) and sect. Emarginatae (D. nervosa, D. stachyoides, and D. patula). In addition, there are several less well-supported clades. Disa thodei, D. crassicornis, and D. stairsii and also D. polygonoides, D. fragrans, and D. versicolor are grouped together, although within this grouping the subclades have better support. The grouping of D. obtusa and D. telipogonis supports their classification in sect. Falcipetalum. A poorly supported clade including D. saxicola, D. oreophila, D. lugens, and D. spathulata groups representatives of sect. Stenocarpa and sect. Herschelianthe. The placement of D. ferruginea, D. sagittalis, D. fasciata, D. ocellata, D. cornuta, and D.?densiflora remain largely unresolved.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
), was used in both amplification and sequencing. On sequencing the full trnL intron of several Disa species using automated sequencing at a later stage, it became apparent that a polyA-rich region, located immediately upstream of the "c2" primer binding site, was responsible for this problem. As the amount of phylogenetically informative sequence lost as a result of using this primer was very small, this primer therefore presents a successful alternative to the "c" primer and could also be considered for use in other studies.
The primer sets of Taberlet et al. (1991)
and the c2 primer could not be used to amplify the trnL-trnF region of some taxa in sect. Monadenia. The amplification of both the intron and the spacer was unsuccessful in two species (D. bracteata and D. brevicornis), in spite of the fact that the isolated DNA could be shown to be intact. The intron region of D. graminifolia could also not be amplified, although the sequence of the spacer could be obtained. Possibly mutations have occurred in the chloroplast tRNA genes of these species, whereby the primers could no longer recognize their relevant regions. However, the intron and spacer region of an unidentified species of this section, (referred to as D.?densiflora), and D. cylindrica could be sequenced and were used as representatives of this section.
Sequence variation within species
Three species, although collected from different localities, showed identical sequences (D. racemosa, D. tripetaloides, Satyrium longicauda). This was not surprising in D. racemosa and Satyrium longicauda, since the localities were close together geographically (
100 km). However, D. tripetaloides showed identical sequences even in specimens collected at the extreme westerly and easterly extremes of its range, a distance of 1000 km. In addition, the western populations of D. tripetaloides flower in summer, whereas the eastern populations flower in winter.
Some species (D. caulescens, D. maculata) did show variation in sequence data within species but revealed indel differences only and no single-base substitutions. Disa caulescens collected from two localities (Groot Winterhoek and Rivier Sonder End) in two distinct drainage systems (Berg River, draining north into the Atlantic Ocean, and Breede River, draining into the Indian Ocean) differed with regard to a single autapomorphic eight-base insertion (bp 1217–1224) in the trnL intron (see Fig. 1). Although viewed to be the same species according to morphological characters, introgression from the sympatric D. tripetaloides had been suspected at Rivier Sonder End (Linder, 1990
). Although no evidence for this introgression could be found from the sequences of the D. tripetaloides intron and spacer regions, this could be difficult to observe from these sequences due to the maternal inheritance of the chloroplast genome.
Disa maculata from Groot Winterhoek and D. maculata from Silvermine showed identical trnL introns but differed by a large autapomorphic deletion (bp 12–238, i.e., 226 bp) in the trnL-trnF spacer of D. maculata from Groot Winterhoek and a 7-bp insertion (bp 274–280) in the trnL-trnF spacer of D. maculata from Silvermine (Fig. 2). The distance separating these two localities is 140 km. The closely related D. virginalis, which occurs sympatrically with and is vegetatively indistinguishable from D. maculata in Groot Winterhoek (Linder et al., 1998
), also has an identical trnL intron but possesses a single 2-bp insertion (bp 311–312) in trnL-trnF spacer and does not possess the 226 bp deletion or the 7-bp insertion that distinguishes the D. maculata forms from Muizenberg and Silvermine.
|
, a repeat arises by slipped-strand mispairing (SSM) mechanisms and, once this repeat has been created, the likelihood that more copies of the repeats evolve becomes even greater. Evidence that such mechanisms play a role in the evolution of the chloroplast genome, specifically in the rpoC2 gene of grasses, has also been presented (Cummings, King, and Kellogg, 1994
). In Disa, the evidence of repeats in regions A, B, and C found here (i.e., that some species possess single repeats, some species possess a few repeats, and others possess large numbers of repeats) suggests that these repeats evolved by single-strand mispairing mechanisms. The numerous repeats found in D. glandulosa in region A, in D. oreophila in region B, and in D. lugens in region C support this inference. The evidence within D. glandulosa, in which two haplotypes of the chloroplast genome possessing different numbers of repeats in region A and B were found (referred to as D. glandulosa 1 and D. glandulosa 2), is an illustration of these evolutionary mechanisms at the within-species level. Due to the large differences in size between the D. glandulosa 1 and D. glandulosa 2 PCR products, a population analysis would be possible using PCR and agarose gel electrophoresis alone without further sequencing. Such studies could shed more light on the role of SSM mechanisms in the generation of repeat regions. Unless the number of repeats in two species is identical, this information is not phylogenetically informative. As this was rarely the case within Disa, the repeat regions contributed little phylogenetic information. However, this information may be more informative at the population level in species such as D. glandulosa. In closely related species such as D. thodei and D. crassicornis, which differed only by one base change in repeat region B and numbers of repeats in region A, this information may also be informative in delineating species boundaries and warrants further examination by us. The mode of evolution by which the single base change in D. thodei is found in all the repeats can only be explained by either an identical repeat event occurring in D. thodei after the base substitution event or by a concerted phenomenon, in which the base substitution, occurring after the repeat has formed, is propagated throughout the repeated copies, perhaps by an unequal crossing-over mechanism.
Range of utility of the trnL-trnF region
The utility of the trnL-trnF region in resolving the phylogenetic relationships in the Disinae appears to be good. Although resolution of some sections was poor, these sections were also poorly sampled and higher sampling may give more resolution.
Monophyly of the major clades of Diseae
The monophyly of the Disinae using the trnL-trnF region is well supported and corroborates the findings of Douzery et al. (1999)
. In addition, the monophyly of Satyrium, Habenaria, Corycium, and Brownleea is supported in each case. Habenaria is subdivided into two strongly supported subclades, which is possibly an indication of polyphyly within the genus, as other authors have found (Pridgeon et al., 1997
; Bateman, 2001
; Bateman et al., 2001
). However, the monophyly of these genera cannot be expanded to their respective subtribes, since the sampling was restricted to include only the most species-rich genus in each subtribe. Although the relationships between these groupings are not strongly supported, the relatively high bootstrap value at the basal node of the tree does support inclusion of Habenaria within the Diseae. This is not congruent with maintaining the two tribes Orchideae and Diseae, as implied by the current taxonomies (Dressler, 1993
; Linder and Kurzweil, 1999
), and also contradicts phylogeny based on morphological characters (Linder and Kurzweil, 1994
), although the latter did not test the monophyly of Diseae. However, these results are consistent with those of Douzery et al. (1999)
using the ITS region and Cameron et al. (1999)
based on rbcL sequence data. Thus, all three molecular sequences investigated to date suggest that Diseae and Orchideae are not reciprocally monophyletic and consequently that recognizing both would not be consistent with the principles of monophyly. A possible taxonomic and nomenclatural solution would be to include the Diseae under Orchideae, but to retain those subtribes that show evidence of monophyly.
Phylogeny within Disinae
Although there are numerous discrepancies between the cladogram obtained here and the taxonomy established by Linder (1981a–d)
, there are also many similarities.
The first clade contains the taxonomically anomalous species D. vaginata and D. glandulosa. These were originally included in sect. Coryphaea, but subsequent morphological phylogenetic analyses (Linder and Kurzweil, 1999
) indicated that they occupied a rather isolated position and might be misplaced in sect. Coryphaea. These morphological indications are strongly corroborated here. Furthermore, these two species are self-pollinating (Johnson, Steiner, and Kurzweil, 1994
) as opposed to other members of the section, which are cross-pollinating. The grouping of D. sagitallis, the other member of the section included in the study, in the third clade, lends further support to this apparent split of sect. Coryphaea.
The second division separates sect. Disa from the rest of the genus. The patterns within sect. Disa are not congruent with the morphological cladogram of Linder and Kurzweil (1999)
. Remarkably, D. bivalvata is not grouped with D. atricapilla. These two species are morphologically very similar and were in the past separated as the genus Orthopenthea (Rolfe, 1912–1913), and although Linder (1981a–d)
included the segregate genus in Disa, the morphological analysis found strong support for the clade. It is possible that the similarity is due to both species having a similar pollination system (both are pollinated by sexual mimicry: Steiner, Whitehead, and Johnson, 1994
), but they hybridize in nature, suggesting substantial genetic similarity. Even more convincing is that the two species share several vegetative peculiarities, such as a basal brush of linear leaves and a stout, almost naked culm. These cannot be attributed to a similar pollination system. Another anomaly is the separation of D. venosa and D. racemosa. As in the case of D. atricapilla and D. bivalvata, these two species are morphologically so similar that D. venosa was regarded as a subspecies of D. racemosa by Schlechter (1901)
, and the morphological phylogeny of Linder and Kurzweil (1999)
suggests that they are sister species, relatively isolated from the rest of the section. Conversely, the molecular phylogeny failed to detect the morphological clade of D. tripetaloides, D. aurata, D. cardinalis, D. uniflora, and D. caulescens. This clade is largely based on the presence of stolons, rather than floral characters. A notable exclusion from this division is D. fasciata. However, D. fasciata is morphologically rather different from the rest of sect. Disa; its spreading tepals mimic the flowers of Adenandra (Rutaceae).
The remaining species of Disa group in a third large division. The first clade, containing all three species from sect. Phlebidia (D. maculata, D. virginalis, D. longicornu), is strongly supported. These three species inhabit rock walls and cracks and have very similar vegetative morphology. However, the placement of sect. Phlebidia here, rather than with sect. Disa, indicates that the monophyly of subgenus Disa, as delimited by Linder (1981a–d)
, is contradicted. Both sections have been extensively sampled (all known species of sect. Phlebidia have been included in this study), so these results cannot be the consequence of sampling bias.
Sect. Emarginatae is retrieved with 100% bootstrap value, supporting the morphological phylogenetic analysis where the section is diagnosed by a shallow dorsal groove on the galea. This section includes six species, so half of the species have been sampled here. One species in the section, D. buchenaviana, is restricted to Madagascar and confirming the position of the species within this well-supported section could suggest recent dispersal to Madagascar.
Herschelia was separated from Disa by Lindley (1830–1840)
. The group has since alternately been recognized at generic level (Rolfe, 1912–1913
; Linder, 1981c
) and as a section of Disa (Schlechter, 1901
; Linder and Kurzweil, 1999
). Linder and Kurzweil (1999)
regard it as closely related to sect. Stenocarpa, with which it shares a similar leaf anatomy (Kurzweil et al., 1995
). This view is corroborated here, where two representatives of sect. Stenocarpa (D. saxicola, D. oreophila) group with the two representatives of sect. Herschelianthe (D. lugens, D. spathulata). However, the bootstrap support for all of these relationships is weak. In addition, D. ferruginea, which on morphological grounds is intermediate between sect. Stenocarpa and sect. Herschelianthe, is not included in the group, and instead occupies a solitary position at a lower node. The sampling of these two sections has been rather poor: sect. Herschelianthe includes 16 species (with two species sampled), and sect. Stenocarpa contains 15 species (with three species sampled). Better sampling might result in stronger support for the relationships between the two sections. The exclusion of D. ferruginea could either reflect the morphological diversity in the two sections (indicating that more morphologically disparate species have in the past been incorrectly included in these two sections) or be an artifact of the relatively poor sampling.
Evidence for monophyly of sect. Disella is present but weak; Disa obtusa and D. telipogonis are grouped together strongly, but D. ocellata and D. uncinata remain poorly resolved. Morphological evidence for the section is also modest, leaving open the possibility that the section is not monophyletic.
The further weakly supported clade contains three sections: sect. Stoloniferae (represented by D. stairsii), sect. Micranthae (D. polygonoides, D. fragrans), and sect. Hircicornes (D. thodei, D. crassicornis, D. versicolor). The nodes within these two sections are generally well supported; they indicate that sect. Hircicornes might be polyphyletic and sect. Micranthae paraphyletic. Section Micranthae is morphologically very distinct, delimited by a suite of characters that includes erect anthers, pendulous spurs, and bilobed petals. The morphological analyses of Linder and Kurzweil (1990)
suggested that the section (which was recognized as a subgenus by Linder, 1981b
) might be a sister-group to the rest of the genus, though later analyses (Johnson, Linder, and Steiner, 1998
) suggested a position adjacent to sect. Hircicornes. However, on morphological grounds it would appear unlikely that the section is paraphyletic. The polyphyly of sect. Hircicornes is possibly less surprising, since the section occupies a central position among the species possessing separate sterile shoots, and soft, unthickened, broad green leaves. It is possible that these results are anomalous due to poor sampling: sect. Hircicornes includes 15 species, of which only three have been sampled, and only two species of the mainly tropical 23 species in sect. Micranthae have been analyzed, both belonging to the basal series of the section.
Monadenia, which was first separated from Disa by Lindley, has experienced a very similar taxonomic history to Herschelia, being alternately recognized at generic or sectional level. Although Disa (Monadenia) cylindrica groups in the first division of the genus and Disa ?densiflora groups in the second, this does corroborate Schlechter (1901)
, who regarded Monadenia as a section of Disa. The inclusion of D. cylindrica as the basal element of the first division is, however, inconsistent with morphological evidence. Linder (1981a–d)
originally included it in sect. Coryphaea, but Linder and Kurzweil (1999)
transferred the species to sect. Monadenia, based on its single viscidium and pendulous spur. However, it lacks many of the features typical of sect. Monadenia. The position of Disa ?densiflora (as a representative of 16 species of this section) in this analysis as sister to sect. Emarginatae is inconsistent with its placement as sister to sect. Hircicornes by Linder and Kurzweil (1999)
, but neither the morphological evidence nor the molecular is wholly convincing. Denser sampling of this section is required to give greater definition to the placement of this section within the genus.
Perspectives
This analysis has raised many tantalizing problems in the sectional classification of the species-rich orchid genus Disa. Most morphologically delimited sections are either not monophyletic or contain some apparently misplaced elements. However, the results raise more questions than provide answers, and to resolve these it will be necessary to expand the species sampling. It will be important to include many more species of each section, and this applies particularly to those sections represented by single species. It will be particularly interesting to obtain examples of Schizodium, the sister genus of Disa within the Disinae, as well as sampling the Indian Ocean and tropical species more extensively. The inclusion of additional sequences from another gene, such as the more variable nuclear ITS gene, should contribute to more definitive resolution of the currently weakly supported clades.
The identification of repeat sequences in the trnL intron in Disa, and the occurrence of variations in the number of these repeats within species, may be of value in population studies in Disa or in the related Habenaria in which they have been reported to occur. They may also be of use in the delimitation of species boundaries within Disa. In addition, these regions may give important insights into the evolution of the trnL intron through SSM mechanisms in the subfamily Orchidoideae.
|
|
|
|
FOOTNOTES |
|---|
5 Author for reprint requests (dub{at}sun.ac.za
).
|
LITERATURE CITED |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Bateman R. M. P. M. Hollingsworth J. Preston Y.-B. Luo A. M. Pridgeon M. W. Chase 2001 Phylogenetics: Orchidinae. In A. M. Pridgeon, P. L. Cribb, M. W. Chase, and F. N. Rasmussen [eds.], Genera Orchidacearum, vol. 2, Orchidoideae, 225–233. Oxford University Press, Oxford, UK
Cameron K. M. M. W. Chase W. M. Whitten P. J. Kores D. C. Jarrell V. A. Albert T. Yukawa H. G. Hills D. H. Goldman 1999 A phylogenetic analysis of the Orchidaceae: evidence from rbcL nucleotide sequences. American Journal of Botany 86: 208-224
Cummings M. P. L. M. King E. A. Kellogg 1994 Slipped-strand mispairing in the plastid gene: rpoC2 in grasses (Poaceae). Molecular Biology and Evolution 11: 1-8[Abstract]
Douzery E. J. P. A. M. Pridgeon P. Kores H. P. Linder H. Kurzweil M. W. Chase 1999 Molecular phylogenetics of Diseae (Orchidaceae): a contribution from nuclear ribosomal ITS sequences. American Journal of Botany 86: 887-899
Doyle J. J. Doyle 1987 A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11-15
Dressler R. L. 1993 Phylogeny and classification of the orchid family. Cambridge University Press, Cambridge, UK
Eriksson T. N. Wikström 1995 AutoDecay. Stockholm University, Stockholm, Sweden
Fangan B. M. B. Stedje O. E. Stabbetorp E. S. Jensen K. S. Jakobsen 1994 A general approach for PCR-amplification and sequencing of chloroplast DNA from crude vascular plant and algal tissue. BioTechniques 16: 484-494[ISI][Medline]
Farris J. S. 1969 A successive approximations approach to character weighting. Systematic Zoology 18: 374-385[CrossRef]
Farris J. S. 1989 The retention index and the rescaled consistency index. Cladistics 5: 417-419[ISI]
Felsenstein J. 1985 Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791[CrossRef][ISI]
Giribet G. W. C. Wheeler 1999 On gaps. Molecular Phylogenetics and Evolution 13: 132-143[CrossRef][ISI][Medline]
Harley E. H. 1998 DNA and Protein sequence alignment DAPSA. Computer program distributed as shareware by the author, University of Cape Town, Cape Town, South Africa
Johnson S. D. H. P. Linder K. Steiner 1998 Phylogeny and radiation of pollination systems in Disa (Orchidaceae). American Journal of Botany 85: 402-411[Abstract]
Johnson S. D. K. Steiner H. Kurzweil 1994 Auto-pollination in Disa species (Orchidaceae) of the Cape Mountain cloud zone. Lindleyana 9: 3-6
Kurzweil H. H. P. Linder W. L. Stern A. Pridgeon 1995 Comparative vegetative anatomy and the classification of the Diseae (Orchidaceae). Botanical Journal of the Linnean Society 117: 171-220[CrossRef]
Levinson G. G. A. Gutman 1987 Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Molecular Biology and Evolution 4: 203-221[Abstract]
Linder H. P. 1981a Taxonomic studies on the Disinae III. A revision of Disa Berg. excluding Sect. Micranthae. Contributions from the Bolus Herbarium 9: 1-370
Linder H. P. 1981b Taxonomic studies on the Disinae IV. A revision of Disa Berg. Sect. Micranthae. Bulletin du Jardin Botanique National de Belgique 51: 255-346[CrossRef]
Linder H. P. 1981c Taxonomic studies on the Disinae VI. A revision of the genus Herschelia. Bothalia 13: 365-388
Linder H. P. 1981d Taxonomic studies on the Disinae V. A revision of the genus Monadenia. Bothalia 13: 339-363
Linder H. P. 1986 Notes on the phylogeny Orchidoideae, with particular reference to the Diseae. Lindleyana 1: 51-64
Linder H. P. 1990 Hybrids in Disa (Diseae-Orchidoideae). Lindleyana 5: 224-230
Linder H. P. S. D. Johnson W. R. Liltved 1998 Disa virginalis (Diseae: Orchidoideae: Orchidaceae): a new species from southern Africa. Novon 8: 405-407[CrossRef][ISI]
Linder H. P. H. Kurzweil 1990 Floral morphology and phylogeny of the Disinae (Orchidaceae). Botanical Journal of the Linnean Society 102: 287-302
Linder H. P. H. Kurzweil 1994 The phylogeny and classification of the Diseae (Orchidoideae: Orchidaceae). Annals of the Missouri Botanical Garden 81: 687-713[CrossRef][ISI]
Linder H. P. H. Kurzweil 1999 Orchids of Southern Africa. A. A. Balkema, Rotterdam, The Netherlands
Lindley J. 1830–1840 Genera and species of orchidaceous plants. Ridgeways, London, UK
Maddison D. R. 1991 The discovery and importance of multiple islands of most-parsimonious trees. Systematic Zoology 40: 315-328[CrossRef]
Pridgeon A. M. R. M. Bateman A. V. Cox J. R. Hapeman M. W. Chase 1997 Phylogenetics of Subtribe Orchidinae (Orchidoideae, Orchidaceae) based on nuclear ITS sequences. 1. Intergeneric relationships and polyphyly of Orchis sensu lato. Lindleyana 12: 89-109
Rolfe R. A. 1912–1913 Orchidaceae. In W. T. Thiselton-Dyer [ed.], Flora Capensis, vol. V, sect. 3, 1–332. L. Reeve & Co., London, UK
Schlechter R. 1901 Monographie der Diseae. Botanische Jahrbücher für Systematic 31: 134-313
Steiner K. V. B. Whitehead S. D. Johnson 1994 Floral and pollinator divergence in two sexually deceptive South African orchids. American Journal of Botany 81: 185-194[CrossRef][ISI]
Swofford D. L. 1993 PAUP: phylogenetic analysis using parsimony, version 4.1. Illinois Natural History Survey, Champaign, Illinois, USA
Taberlet P. L. Gielly G. Pautou J. Bouvet 1991 Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105-1109[CrossRef][ISI][Medline]
This article has been cited by other articles:
|
|
 |
|
  J. Shaw, E. B. Lickey, J. T. Beck, S. B. Farmer, W. Liu, J. Miller, K. C. Siripun, C. T. Winder, E. E. Schilling, and R. L. Small The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis Am. J. Botany, January 1, 2005; 92(1): 142 - 166. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. A. Salazar, M. W. Chase, M. A. Soto Arenas, and M. Ingrouille Phylogenetics of Cranichideae with emphasis on Spiranthinae (Orchidaceae, Orchidoideae): evidence from plastid and nuclear DNA sequences Am. J. Botany, May 1, 2003; 90(5): 777 - 795. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
