|
|
||||||||
2Harvard University Herbaria, 22 Divinity Avenue, Cambridge, Massachusetts 02138; and 3Universität Hamburg, Institut für Allgemeine Botanik und Botanischer Garten, Ohnhorststr. 18, 22609 Hamburg, Germany
Received for publication July 21, 1998. Accepted for publication January 21, 1999.
| ABSTRACT |
|---|
|
|
|---|
Key Words: angiosperm phylogeny Bombacaceae Malvaceae Malvales ndhF phylogenetic nomenclature stamen evolution Sterculiaceae Tiliaceae
| INTRODUCTION |
|---|
|
|
|---|
250 spp.), Malvaceae (
1500 spp.), Sterculiaceae (
1000 spp.), and Tiliaceae (
400 spp.). The close relationship among these core families has been recognized since the time of Linnaeus and was recently confirmed by molecular data (Chase et al., 1993
The core Malvales constitute one of four major clades within an expanded Malvales clade, which also includes Bixaceae, Cistaceae, Cochlospermaceae, Dipterocarpaceae, Muntingiaceae, Neuradaceae, Sarcolaenaceae, Sphaerosepalaceae, and Thymelaeaceae (Alverson et al., 1998
; Fay et al., 1998
; Bayer et al., 1999
). The expanded Malvales clade (or, simply, "Malvales"; APG, 1998) is associated with the Capparales and the Sapindales within the Rosid II clade of Chase et al. (1993)
. Now that the broader phylogenetic context has been established, the opportunity exists to clarify relationships within the core Malvales (termed "Malvaceae" by Judd and Manchester, 1997
; APG, 1998; and Bayer et al., 1999
).
The boundaries between the four core malvalean families have been notoriously difficult to pin down and there are several genera (e.g., Camptostemon, Chiranthodendron, Corchoropsis, Craigia, Fremontodendron, Hampea, Maxwellia, Nesogordonia, and Uladendron) that have been shuffled among them in traditional classification schemes (e.g., Edlin, 1935
; Hutchinson, 1967
; Robyns, Nilsson, and Dechamps, 1977
; Takhtajan, 1987
, 1997; Tang, 1990
). Within the four families there are similar problems in the delimitation of tribes and subfamilies, which are reflected in some marked differences among traditional taxonomic treatments (Table 1). Furthermore, even those suprageneric taxa that were agreed upon by these systematists are not necessarily reliable. For example, Durio and its relatives (Durioneae) have been universally placed within the Bombacaceae, but this position was recently questioned based on morphology, biogeography, and chromosome number (Baum and Oginuma, 1994
; Judd and Manchester, 1997
).
|
A recent morphological cladistic analysis attempted to improve knowledge of the relationships within the core Malvales (Judd and Manchester, 1997
), but obtained little robust resolution except for confirmation of the monophyly of the traditional Malvaceae. Thus, knowledge of the phylogeny of the core Malvales remains limited, obscuring knowledge of the group's morphological evolution and biogeography. In particular, the androecium is quite varied within the core Malvales (van Heel, 1966
), but this variation is refractory to investigation in the absence of a well-resolved phylogeny.
In this study we attempted to advance understanding of the phylogeny of core Malvales using sequences of the chloroplast gene ndhF, which has been used successfully to elucidate phylogenetic relationships at the infraordinal level (e.g., Clark, Zhang, and Wendel, 1995
; Smith et al., 1997
). This gene encodes a subunit of the nicotinamide dehydrogenase complex and shows approximately twice the average mutation rate of rbcL (Suguira, 1989
; Olmstead and Sweere, 1994
). Our goal was to identify large-scale phylogenetic structure within core Malvales and to provide a better understanding of the relationships among the major subfamilial groups. This study parallels independent investigations of Malvales phylogeny using rbcL and atpB sequences (Bayer et al., 1999
) and the nuclear gene PLD (F. Blattner, IPK, Gatersleben, personal communication).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Laboratory methods
Our DNA extractions were modified Zimmer or 2X-CTAB procedures (protocols A and C in Smith et al., 1990
), or procedures associated with DNeasy columns (Qiagen Corp. number 69104, Valencia, California). We generally used four polymerase chain reaction (PCR) primers that provided two products of 1370 and 1139 bp, with an overlap of 347 bp. For difficult taxa, additional, internal PCR primers were used. PCR products were diluted and used in the cycle sequencing reactions or were first cleaned with QlAquick columns (Qiagen Corp. numbers 28104 and 28704). Overlapping sequence fragments were obtained from both strands of the gene using a total of 1216 primers. Primers were obtained from Olmstead, Sweere, and Wolfe (1993)
and were modified in four instances for Malvales (536F, TTGTAACTAATCGGATAGGCGA; 972F, GTCCCAACTGGGTTATATGATG; and their respective complementary primers, 536R and 972R). Dideoxy-terminated cycle sequencing products were sequenced on ABI 370A and 377 automated DNA sequencers using Long Ranger acrylamide gels (FMC Bioproducts, Rockland, Maine). The contigs were assembled and checked for stop codons using Sequencher 3.0 (Gene Codes Corp., Ann Arbor, Michigan). Bases from positions -52 to -1 and from 2227 to 2252 were removed to avoid primer artifacts. The sequence from each taxon was aligned and gapped by visual inspection, a generally easy process. All newly generated sequences were submitted to GenBank (Table 1) and the aligned data were submitted to TreeBASE (www.herbaria.harvard.edu/treebase). Descriptive statistical data were generated with the BSS program (R. Nyffeler, unpublished data) from the entire ndhF gene, as well as separately for the 5' and 3' ends, split between base positions 1350 and 1351, comparable to the boundary used by Kim and Jansen (1995)
and corresponding to positions 1329 and 1330 of the Nicotiana sequence (cf. Olmstead, Sweere, and Wolfe, 1993
). All ambiguous sites were scored as "?" for these descriptive statistics. Variable sites were scored as 2-fold transitions (two states related by a transition), 2-fold transversions (two states related by a transversion), 3-fold sites (with three states observed), and 4-fold sites. Finally, indel events were referenced to the ndhF sequence of Nicotiana (Olmstead, Sweere, and Wolfe, 1993
; GenBank L14953).
Phylogenetic analyses
For a preliminary analysis using all 70 taxa, we ran 100 random addition sequence (RAS) equally weighted parsimony searches with tree bisection reconnection branch swapping (TBR), hold = 1, MULPARS and steepest descent on, gaps scored as missing, and zero-length branches collapsed using PAUP* versions 4.0d64 and 4.01b (Swofford, 1998
) on a PowerMac 8500/150. The shortest trees were condensed and then summarized by a strict consensus tree. The phylogenetic signal present in the full ndhF data set was estimated using PAUP* based on the skewness of the length distribution of 100 000 random trees (Hillis and Huelsenbeck, 1992
; but see Källersjö et al., 1992
).
An excessive number of trees were attributable to one poorly resolved clade of genera traditionally placed in or near Bombacaceae, tribe Bombaceae. We assessed the robustness of this clade by decay analysis (Bremer, 1988
; Donoghue et al., 1992
) using inverse constraints and 100 RAS searches with MULPARS off. The core Bombacaceae clade was then reduced from 11 to five taxa for all further analysis. Most parsimonious trees for the 64-taxon data set were estimated using 100 RAS parsimony searches, as above. In order to explore other weighting schemes, we ran five sets of ten RAS parsimony searches under each of the following conditions: (1) transition/transversion stepmatrix weights of 2:1 and 5:1, respectively; (2) same two stepmatrices plus codon weighting of 1, 1, 0.5; (3) same two stepmatrices plus codon weights of 1, 1, 0; (4) same two stepmatrices plus equally weighted codon positions, and gapped characters deleted; (5) no stepmatrices, equally weighted codons, and gapped characters deleted.
The strength of support for each clade found during the 64-taxon equally weighted parsimony searches was assessed using PAUP* 4.0b1 (Swofford, 1998
) by obtaining its decay index (di), using 100 RAS inverse constraint searches (otherwise as above), and by bootstrap values (bs), using ten RAS searches per pseudoreplicate (as above but with MAXTREES = 100). We also used the shortest trees in which the monophyly of each clade of interest was not supported (from the decay analyses) and then evaluated the significance of the extra steps required by these trees using a Wilcoxon sign-rank test (Templeton, 1983
). Results of these Templeton tests are reported below only when they are significant. The cost of some specific topological arrangements not found on the shortest trees was assessed by conducting inverse monophyly constraint searches. The aligned data set and most parsimonious trees from this study are available from TreeBASE (www.herbaria.harvard.edu/treebase; S388 and M542).
Nomenclature
We refer to clades discovered during the course of this study by a set of unranked, phylogenetic taxon names as published by Baum, Alverson, and Nyffeler (1998)
and by traditional, ranked names proposed by Bayer et al. (1999)
. Although the phylogenetic names have no official status until a code governing such names is published (DeQueiroz and Gauthier, 1992, 1994
), these rankless names offer several potential advantages over traditional names (de Queiroz, 1997
; Baum, Alverson, and Nyffeler, 1998
). Two conspicuous benefits of phylogenetic names relative to the taxonomy of core Malvales are: they are explicitly defined, independent of subjective rank assessment; and they allowed us to name all significant, well-supported clades. The phylogenetic names used here are in most cases identical in name and inferred content to the traditional subfamily, family, and ordinal names proposed by Bayer et al. (1999)
. However, the correspondence between our named clades and the named groups of Bayer et al. is not always exact because that study did not provide phylogenetic definitions and sometimes recognized paraphyletic groups. Additionally, some of the clades, discussed below, were not named by Bayer et al. To distinguish traditional taxa (e.g., Malvaceae) from unranked clade names, the latter are marked here by a preceeding slash mark (e.g., /Malvaceae).
| RESULTS |
|---|
|
|
|---|
The shortest, uncorrected pairwise distance within the ingroup is between Chiranthodendron and Fremontodendron (0.24%) and the largest is between Waltheria and Malope (6.91%). The largest distance overall is 11.29%, between Waltheria and Muntingia (an outgroup). The distribution of variable sites ranges from 3 (10%) to 21 (70%) per 30-bp segment. The contrast between the abundance of variable sites in the 5' region (31% for bases 1-1350) and the 3' region (47.2% for bases 1351-2226) is not as strong as that seen by Kim and Jansen (1995)
for Asteraceae. Overall GC content is 32.6%, with a marked difference between the 5' region (35.2%) and the 3' region (28.2%). The 2-fold transition sites comprise 15.8% of the variable sites and are evenly distributed over the gene with no marked differences between the 5' and 3' regions (Table 2). However, 2-fold transitions at the second codon position were more than twice as common for the 3' as for the 5' end, whereas transitions at the third codon position were proportionately more common at the 5' end. This pattern of reduced second position variation at the 5' end and reduced third position variation at the 3' end reoccurs for other types of sites (Table 2), suggesting a greater conservation of amino acids at the 5' end.
|
|
Therefore, we removed six of these taxa and reran the equally weighted parsimony analysis with 64 taxa. This yielded 46 trees at 1666 steps on one island found in all 100 RAS searches (CI = 0.650, RI = 0.682, g1 = -0.5739, 431 informative characters). The strict consensus of the 46 trees is shown in Fig. 2. One of the 46 trees is shown in Fig. 1, onto which phylogenetically informative indel events were mapped by simple parsimony. Unequally weighted parsimony searches of the 64-taxon data set produced trees with a reduced resolution of core bombacoids and basal malvoids (see below) but with only one minor change in the composition of subclades, as noted below. Overall, branch lengths in the shortest trees found in these searches differed noticeably among subclades in a way that did not appear to be an artifact of our sampling. The shortest average branch lengths occurred in the core bombacoids (Fig. 1). This may be due to the fact that core bombacoids are generally large trees, given the general negative correlation between generation time and the rate of molecular evolution (Gaut et al., 1992
; Baum, Small, and Wendel, 1998
), or may relate to the high chromosome numbers found in this group (cf. Baum and Oginuma, 1994
).
|
The first major clade, /Malvadendrina (Fig. 2), contains all exemplars of traditional Malvaceae and Bombacaceae, plus elements of traditional Sterculiaceae and Tiliaceae. The clade is strongly supported by bootstrap and decay values (di = 4; bs = 87) and is marked by a distinctive and unreversed 21-bp deletion (Fig. 1). Relationships within /Malvadendrina are poorly resolved, but eight subclades can be recognized (Fig. 2). We discuss the composition of these subclades and their support from morphological data, below. The second major clade, /Byttneriina (Fig. 2), contains exemplars from several tribes of Sterculiaceae and Tiliaceae. It is well supported by bootstrap and decay values (di = 4; bs = 85) and by a 6-bp insertion that is subsequently lost in three member taxa (Fig. 1). Two subclades within /Byttneriina are shown in Fig. 2 and considered further, below.
| DISCUSSION |
|---|
|
|
|---|
/Malvadendrina (Fig. 2; unnamed by Bayer et al., 1999)
This clade is strongly supported by molecular data (Figs. 1 and 2; also Bayer et al., 1999
). It is divided here into seven subclades: /Malvoideae, /Bombacoideae, /Sterculioideae, /Dombeyoideae, /Tilioideae, /Brownlowioideae, and /Helicteroideae. The relationships among these subclades are unresolved, except for the clade formed by /Malvoideae and /Bombacoideae (the /Malvatheca clade; Fig. 2; Baum, Alverson, and Nyffeler, 1998
), which has moderate molecular support (di = 4; bs = 84).
Although the relationships among the /Malvatheca clade and the other five subclades of /Malvadendrina are not resolved by these data, there exist morphological characters that could serve to link some of these subclades. Members of /Brownlowioideae, /Helicteroideae, /Sterculioideae, and /Malvatheca have sepals fused into a tubular or campanulate, often lobed calyx. Burret (1926)
recognized the potential value of this character and divided Tiliaceae into two major groups based on ";t1calyx symphyllus, campanulatus, superne lobatus" vs. "sepala libera," with the former group containing his Brownlowioideae, all exemplars of which here fall into /Brownlowioideae (Fig. 2). In contrast, the sepals of most /Dombeyoideae and /Tilioideae are fused only slightly at the base or are essentially unfused. If one assumes that the plesiomorphic condition for sepals in core Malvales is of unfused sepals (as found for example in Bixaceae), then the fusion of sepals would tend to unite /Malvatheca with /Brownlowioideae, /Helicteroideae, and /Sterculioideae. However, homoplasy cannot be avoided under this scenario because of the essentially unfused sepals of Robinsonella (Malvaceae, probably /Malvoideae) and the occurrence of fused sepals in some members of the /Byttneriina clade (see below).
/Malvatheca, and most /Helicteroideae, /Dombeyoideae, and /Sterculioideae also have staminal tubes, i.e., filaments partially to completely fused into a ring. This provides another potential character for resolving relationships among the lineages of /Malvadendrina, perhaps suggesting a basal position for /Brownlowioideae and /Tilioideae.
/Malvoideae (Fig. 2; cf. the Malvoideae of Bayer et al., 1999)
At the core of /Malvoideae there is a weakly supported monophyletic group (di = 1; bs = 69) containing all exemplars traditionally placed in the Malvaceae. Hampea, which has been sometimes placed in the Bombacaceae (e.g., Hutchinson, 1967
; Takhtajan, 1987
), also falls in this core clade, as predicted by Fryxell (1968)
based on chromosome number and other characters. Our study suggests further additions to the base of the /Malvoideae, particularly Camptostemon (di = 8; bs = 100; Templeton P = 0.079), which was described by Masters (1875)
as a "genus curiously intermediate between Durioneae and Malveae." This mangrove genus and its apparent close relative Papuodendron have been placed either in Durioneae (Bombacaceae) because of their indumentum of peltate scales and cup-like epicalices, or in Malvaceae (White, 1946
; Kostermans, 1960
). Features linking both genera to other /Malvoideae are staminal tubes, spiny pollen, and seeds with a medial ridge of long, bristly hairs, resembling those of some species of Hibiscus.
Matisia, Phragmotheca, and Quararibea, traditionally Bombacaceae, tribe Matisieae, appear monophyletic, as predicted from their shared, fleshy-fibrous, drupaceous fruits (Alverson, 1991
). Baum, Alverson, and Nyffeler (1998)
named this clade /Matisieae. The weakly supported inclusion of /Matisieae in /Malvoideae (di = 1; bs = 54) is quite plausible because of their seemingly "monothecate" anthers, highly fused staminal filaments (but with thecae sessile, in contrast to the stalked thecae of Camptostemon and traditional Malvaceae), tubular calyces, and simple, usually palmately veined leaves. However, none of these characteristics is a unique synapomorphy linking them with other /Malvoideae.
Chiranthodendron and Fremontodendron (Fremontieae, Sterculiaceae) here form a strongly supported clade (di = 4; bs = 98), as was expected (e.g., Bentham and Hooker, 1867
, p. 982, as Cheirosternon and Fremontia). The uncertain relationship of these apetalous genera to other core Malvales was reviewed by Kelman (1991)
. Data from ndhF place them as a sister group to all other /Malvoideae, but the position is weakly supported (di = 1; bs = 52). In view of this, it is noteworthy that Fremontodendron and Quararibea were placed close to the /Malvoideae in some of the most parsimonious trees found by Judd and Manchester (1997)
. Alternatively, they have often been placed in the Sterculiaceae on the basis of their seemingly bithecate, tetrasporangiate anthers and apetalous flowers with colorful calyces (Table 1). However, the nature of these anthers and their potential utility as a synapomorphy are considered in the separate discussion of staminal characters, below. Apetaly and concomitant changes in calyces appear to have arisen in several lineages (e.g., some /Sterculioideae, Grewia, Heliocarpus, Triumfetta, and Lasiopetaleae), and thus do not provide compelling synapomorphies that would serve to unite Chiranthodendron and Fremontodendron with other traditional Sterculiaceae.
/Bombacoideae (Fig. 2; cf. the Bombacoideae of Bayer et al., 1999)
The monophyly of the group containing most traditional Bombacaceae, exclusive of Durioneae and Matisieae, is neither supported nor rejected by these data. In other words, our study was equivocal as to whether Ochroma and Patinoa comprise a single clade with the other core Bombacaceae. If they form a clade, then these two genera would seem to occupy the basal position. Ochroma and Patinoa have simple leaves, many seeds, and highly fused staminal filaments and, thus, resemble Chiranthodendron and Fremontodendron, which fall at the base of the /Malvoideae. Furthermore, the leaf characteristics of Ochroma (shape, indument, texture) and its petaloid-margined calyces are extremely similar to those of Chiranthodendron (and only slightly less so to those of Fremontodendron), suggesting either a close relationship between these genera or that these characters are plesiomorphic for the /Malvatheca. One of the parsimony analyses (with both stepmatrices, equal codon weights, and gapped characters deleted) moved Patinoa to a sister position with Bernoullia, accentuating the need for further investigation of relationships within the /Bombacoideae.
Exclusive of Ochroma and Patinoa, the core /Bombacoideae clade found in the analysis of the full data set of 70 taxa consists of 14 genera. Based on morphology, the unexamined genera Aguiaria, Neobuchia, Rhodognaphalon, and Rhodognaphalopsis almost certainly will fall here also. These core /Bombacoideae share the probable synapomorphy of palmately compound leaves (sometimes unifoliolate, e.g., all Huberodendron and Scleronema, most Catostemma, one Pseudobombax), with a single reversal to simple, palmately veined leaves in Cavanillesia.
/Sterculioideae (Fig. 2; the Sterculioideae of Bayer et al., 1999)
This strongly supported (di = 6; bs = 99), largely Old World clade consists of exemplars of three traditional tribes of Sterculiaceae: Mansonieae, Sterculieae, and Tarrietieae (Table 1). It exhibits several morphological novelties that may serve as local synapomorphies: unisexual or polygamous flowers, apetaly with petaloid sepals, and apocarpy. As noted by Jenny (1988)
, the apocarpy of Sterculia and relatives appears to involve a mechanism differing from that seen in Dombeya (traditionally Dombeyeae) or Keraudrenia (traditionally Lasiopetaleae). Kubitzki (1995)
also reported apocarpy in Brownlowia and Christiana (Tiliaceae). Palmately compound leaves are plesiomorphic in the clade, or evolved at least once in this clade (e.g., Cola, Sterculia), possibly with reversals to cordate, palmately veined, simple leaves. The androgynophores and fused staminal filaments of /Sterculioideae might serve as synapomorphies of this clade, depending on a future assessment of the sister lineage, which was not identified by our analysis.
/Dombeyoideae (Fig. 2; the Dombeyoideae of Bayer et al., 1999)
Exemplars of four traditional tribes of SterculiaceaeDombeyeae, Eriolaeneae, Helmiopsidae, and Helictereaeform this well-supported clade (di = 3; bs = 97), which in the most parsimonious topology is a weakly supported sister clade to the /Tilioideae (di = 1; bs = 58). Within /Dombeyoideae, Dombeya and Eriolaena share a unique 6-bp insertion (Fig. 1). The /Dombeyoideae are native to the Old World. Staminal filaments are fused into short (e.g., some Dombeya) to long (e.g., Pterospermum) staminal tubes, except in Nesogordonia, the basal genus, which has free filaments (Hutchinson, 1967
; Barnett, 1987a
). Ovaries are mostly sessile but borne on a gynophore in Pterospermum. The topology here corroborates the work of Barnett (1987b)
, who proposed that tribes Dombeyeae, Eriolaeneae, and Helmiopsidae (except Nesogordonia) should be combined, based on the combination of hermaphroditic flowers with flat, unappendaged petals, ten or more monadelphous stamens, sessile, syncarpous gynoecia, bifid cotyledons, umbonate sarcotestal projections, and wood anatomical features. She also considered Nesogordonia to be anomalous but linked to other /Dombeyoideae by its wood anatomy.
If further lines of evidence corroborate the membership of the /Dombeyoideae seen here, the polyphyly of traditional Helictereae (with exemplars also in /Helicteroideae and /Byttneriina, below), may be explained by the extensive homoplasy of androgynophores at and below the tribal level in core Malvales. Notably, Zebe (1915)
stated that Pterospermum was not closely related to other Helictereae, despite its stalked ovaries.
/Tilioideae (Fig. 2; the Tilioideae of Bayer et al., 1999)
The familiar genus Tilia appears to be sister to Craigia, a Chinese genus, usually placed in the Tiliaceae (e.g., Ren, 1989
; Takhtajan, 1997
). This clade is well supported (di = 4; bs = 96) and agrees with the morphological cladistic analysis of Judd and Manchester (1997)
, who found that these genera were related based on their oblate, pleurotreme pollen grains, flowers with five, elongate, antipetalous staminodia (in at least some Tilia), and embryos with folded cotyledons.
/Brownlowioideae (Fig. 2; the Brownlowioideae of Bayer et al., 1999)
Exemplars of Tiliaceae, subfamily Brownlowoideae, tribes Berryeae and Brownlowieae, form a strongly supported subclade (di = 6; bs = 96). Based on preliminary ndhF data, Diplodiscus and Jarandersonia (Diplodisceae) also fall into this clade (R. Nyffeler, unpublished data). The /Brownlowioideae are characterized by sepals fused into a campanulate tube (Burret, 1926
), many stamens that are unfused or slightly fused into fascicles at their base, with or without staminodia (Ridley, 1922
; Hutchinson, 1967
), and ovaries sessile or borne on a short stalk ("torus"), i.e., a gynophore. Judd and Manchester (1997)
noted that Brownlowia and Pentace, but not Berrya, have five elongate antipetalous staminodia, like some Tilia. However, it is not clear which of these traits, or others, may serve as a unique synapomorphy for the clade because of its uncertain relationship to other lineages of the /Malvadendrina.
/Helicteroideae (Fig. 2; the Helicteroideae of Bayer et al., 1999)
The /Helicteroideae subclade contains some exemplars of traditional Helictereae (Sterculiaceae) and all core Durioneae (Bombacaceae). This unanticipated but well-supported subclade (di = 4; bs = 100) was sister to all other subclades of /Malvadendrina. However, since the /Helicteroideae could be forced to be a sister to /Malvatheca with only one additional step (Fig. 2), their position is perhaps best regarded as unresolved. We evaluated the traditional hypothesis that members of tribe Durioneae (here represented by Durio and Neesia) are part of Bombacaceae by using monophyly-constraint searches to force Durio and Neesia into the /Malvatheca clade. This requires an additional six steps.
The /Helicteroideae have petals, fused sepals, five to many stamens with mostly unfused (e.g., fascicles in Durio and Neesia) to mostly fused filaments (Helicteres and Reevesia). Some Helicteres and Reevesia have staminodes and staminal thecae that become confluent (Robyns and Cuatrecasas, 1964
; Solheim, 1991
; see also Soepadmo and Eow, 1977
, on Durio). The flattened cotyledons of Durio and Neesia are similar to those found in other Sterculiaceae, as noted by Hutchinson (1967)
, Baum and Oginuma (1994)
, and Judd and Manchester (1997)
and may provide a synapomorphy at some level within /Malvadendrina upon further study.
/Byttneriina (Fig. 2; unnamed by Bayer et al., 1999)
This major clade consists of exemplars of Sterculiaceae and Tiliaceae. The /Byttneriina clade is well supported (di = 4; bs = 85) but, like its sister clade, /Malvadendrina, does not exhibit obvious morphological synapomorphies. Many members of /Byttneriina have leaves with coarsely dentate or doubly serrate margins, but this is likely a plesiomorphic state for core Malvales. This leaf characteristic is also seen in closely related outgroups (e.g., Cochlospermum), as well as in /Dombeyoideae and /Tilioideae, and may be lost under certain ecological conditions (e.g., in some rainforest /Byttnerioideae). The /Byttneriina clade includes at least two subclades supported by this analysis: /Grewioideae and/Byttnerioideae.
/Grewioideae (Fig. 2; the Grewioideae of Bayer et al., 1999)
This strongly supported clade (di = 13; bs = 100; Templeton Ts = -170, p = 0.048) contains exemplars of Tiliaceae, tribes Apeibeae, Coloneae, Corchoreae, Enteleeae, Grewieae, Lueheeae, Pseudocorchoreae, Sparmannieae, and Triumfetteae. The clade gains further support from an unreversed 6-bp insertion (Fig. 1), and a homoplasious 6-bp insertion marks the sublineage to which the exemplars of Corchoreae, Pseudocorchoreae, and Triumfetteae belong.
A potential synapomorphy for /Grewioideae is an epidermal modification of the adaxial petal surfaces. This supposes, however, that the pitted-glandular petals of Colona, Luehea, and Trichospermum are homologous with the carinate surfaces of Corchoreae and Sparmannieae (Hutchinson, 1967
). Loss of sepal fusion also may be a synapomorphy for the group if the basal condition in core Malvales is fused sepals. Assuming that the basal condition for core Malvales is many, free, fertile stamens (cf. potential sister clades such as Cochlospermaceae; see also Judd and Manchester, 1997
), then another potential morphological synapomorphy is the sterilization of the outer stamens, which is seen in some members of /Grewioideae. Stamens with appendages of connective tissue also occur in some members (e.g., Apeiba and Glyphaea) and may help define subclades within /Grewioideae upon further study.
/Byttnerioideae (Fig. 2; the Byttnerioideae of Bayer et al., 1999)
Exemplars of Sterculiaceae tribes Byttnerieae, Helictereae, Hermannieae, Lasiopetaleae, and Theobromeae form this weakly supported clade (di = 1; bs = 52). Two subclades of /Byttnerioideae are suggested by this study. These "byttnerioid" and "lasiopetaloid" subclades were not given formal rankless names by Baum, Alverson, and Nyffeler (1998)
. A separate study by Whitlock et al. (unpublished data) will provide a more thorough sampling and greater phylogenetic detail.
Members of the /Byttnerioideae clade show a general reduction of stamen number compared to /Grewioideae and putative outgroups. Glossostemon, which also falls in the /Byttnerioideae (B. Whitlock, unpublished data), is an exception with 30 stamens (Freytag, 1951
). Another potential synapomorphy of /Byttnerioideae is that the fertile stamens are gathered into antipetalous fascicles and that staminodia, when present, are antisepalous. A preliminary assessment of Rulingia and Commersonia, which fall near the base of the lasiopetaloid clade (B. Whitlock, unpublished data), suggests that another possible synapomorphy for /Byttnerioideae are petals that are broad or concave at their base. Finally, Bayer and Kubitzki (1996)
note that the inflorescence morphology of Keraudrenia, a putatively unspecialized member of the Lasiopetaleae, shows homology to members of Byttnerieae, indicating another potential synapomorphy for /Byttnerioideae.
Traditional Byttnerieae and Theobromeae constitute the moderately supported byttnerioid subclade seen here (di = 3; bs = 58); Kleinhovia (traditionally Helictereae) also falls into this subclade. The separation of Byttnerieae and Theobromeae (subfamily Byttnerioideae) from the rest of traditional Sterculiaceae, predicted by Edlin (1935)
, is supported also by rbcL sequence data (Whitlock, Alverson, and Baum, 1996
; Alverson et al., 1998
; Bayer et al., 1999
). Probable synapomorphies for this subclade include the fusion of filaments into staminal tubes bearing antipetalous fertile stamens at their apices (generally in threes), alternating with antisepalous staminodia, and cucullate-elaborate petal morphology. Kleinhovia shares these morphological traits and is strongly supported as a member of the byttnerioid subclade, an association suggested on morphological grounds by Zebe (1915)
.
The "lasiopetaloids," a second subclade of /Byttnerioideae suggested by this study (di = 5; bs = 88), is composed of Waltheria and Hannafordia, exemplars from tribes Hermannieae and Lasiopetaleae, respectively (both Sterculiaceae). Within lasiopetaloids, staminodia may have been lost in some Hermannieae and, presumably independently, in some Lasiopetaleae. If broadly based petals are a symplesiomorphic condition in the lasiopetaloid subclade, as we suspect, then they have been lost in most members of Lasiopetaleae.
The correspondence of morphology with the ndhF topology
These molecular data suggest that core Malvales have experienced multiple gains (and/or losses) of androgynophores, staminal tubes, palmately compound leaves, palmate- (vs. pinnate-) veined leaves, apetaly, spiny pollen, apocarpy, winged seeds or fruits, the herbaceous habit, and "monothecate" anthers. Thus, none of these character states can serve as an unambigous guide to monophyly at higher levels within /Malvaceae. Nonetheless, this does not preclude the utility of these characters at lower levels. For instance, the presence of a gynophore does not distinguish Sterculiaceae from Tiliaceae in the traditional sense, nor does it appear to serve as a synapomorphy for traditional Helictereae, yet the gain or loss of gynophores may help diagnose lineages within some of the subclades identified by our study. Similarly, the current tree topology suggests that palmately compound leaves were derived at least four times in the core Malvales: in the /Sterculioideae, /Bombacoideae, /Byttnerioideae (Herrania), and /Malvoideae (Cienfuegosia and Gossypium). Despite this homoplasy, the gain of compound leaves may serve as a legitimate synapomorphy for, or within, each of these subclades.
The nature and significance of staminal characteristics in core Malvales have been particularly intriguing. It has long been assumed that monothecate anthers ("half-anthers" or "monoloculate" anthers) offered some clear insight into the structure of the core Malvales, namely, that the presence of this character state was a derived character uniting Malvaceae and Bombacaceae (van Heel, 1966
; Cronquist, 1988
; Judd, Sanders, and Donoghue, 1994
; Judd and Manchester, 1997
).
In contrast, the topologies obtained here suggest that the "monothecate" anthers of some Durio, which have been the basis for traditional placement of this and several other, similar genera (Coelostegia, Cullenia, Kostermansia, and Neesia) in the traditional family Bombacaceae, may not be homologous with the "monothecate" anthers seen in /Malvatheca (cf. van Borssum Waalkes, 1966
). We postulate that the "monothecate" anthers of some Durio and allies were derived from a dithecate ancestor, perhaps by a direct fusion of the adjacent thecae of a single anther (Soepadmo and Eow, 1977
; the secondary disporangy of Endress and Stumpf, 1990
), or by simple splitting of each anther into two separate thecae (e.g., Kostermans, 1960
). In contrast, a superficially similar condition in /Malvatheca may have been derived by an independent, more complicated route, as follows.
The basal branches within the /Malvatheca (including Fremontodendron, Gyranthera, Huberodendron, Ochroma, and Patinoa) all show elongate anthers with transverse septa, suggesting that anthers are "polysporangiate by transverse septation" (Endress and Stumpf, 1990
), rather than "monothecate." Transversely septate anthers are also known from Septotheca (Bombacaceae), which was not included in this study, but which will almost certainly fall near the base of /Malvatheca. All of these genera have their staminal filaments highly fused into a tube, also suggesting that this may be a basal condition in /Malvatheca. In light of the position of these taxa in the phylogeny, it becomes more parsimonious to place polysporangiate anthers as the basal condition, rather than monothecate anthers.
We postulate that one or more reductions in the degree of filament fusion may have occurred subsequently within /Bombacoideae to partially fused (e.g., Ceiba and Pachira) or almost unfused (e.g., Bombax and Catostemma) filaments. In this scenario, as the androecia evolutionarily "unzipped," the free portions of the filaments retained only two of the previously many sporangia from a single anther (with exceptions such as Spirotheca and some Ceiba s.l. which retained more), thus yielding pollen sacs that appear to be monothecate and bisporangiate.
A parallel process may have occurred in /Malvoideae. Each anther of Fremontodendron, the putative basal lineage of /Malvoideae, exhibits elongate, parallel pollen sacs that are transversely divided by septa into 2030 contiguous sporangia (Endress and Stumpf, 1990
). These have been interpreted as dithecate, tetrasporangiate anthers in the past, and hence this genus and the closely related Chiranthodendron have commonly been seen as members of Sterculiaceae (e.g., Kelman, 1991
). We suggest that these anthers may be interpreted alternatively as dithecate and polysporangiate. In /Matiseae, another basal branch of /Malvoideae, Phragmotheca exhibits elongate, transversely septate thecae of irregular lengths with varying numbers of component sporangia (Alverson, 1991
). This genus may represent a developmental state in which some but not all of the thecae have disaggregated to become bi- (vs. poly-) sporangiate, while the filaments themselves remain almost completely fused. Finally, in core /Malvoideae, staminal filaments are completely unfused apically and bear single ("monothecate"), bisporangiate pollen sacs, sometimes in pairs on bifurcating filaments. In sum, under both the traditional and this alternative hypothesis of stamen evolution, it is clear that the androecium of core Malvales shows a level of developmental plasticity that is unusual among eudicots and warrants further study.
| CONCLUSIONS |
|---|
|
|
|---|
|
|
| FOOTNOTES |
|---|
4 Author for correspondence, current address: Environmental and Conservation Programs, The Field Museum, 1400 S. Lakeshore Drive, Chicago, IL 60605-2496 (e-mail: walverson{at}fmnh.org
). ![]()
| LITERATURE CITED |
|---|
|
|
|---|
. 1994 New species and combinations of Catostemma and Pachira (Bombacaceae) from the Venezuelan Guayana. Novon 4: 38.
, K. G. Karol, D. A. Baum, M. W. Chase, S. M. Swensen, R. McCourt, and K. J. Sytsma. 1998 Circumscription of the Malvales and relationships to other rosidae: evidence from rbcL sequence data. American Journal of Botany 85: 876887.[Abstract]
Angiosperm Phylogeny Group (APG). 1998 An ordinal classification for the families of flowering plants. Annals of the Missouri Botanical Garden 85: 531543.[CrossRef][ISI]
Barnett, L. C. 1987a Two new species of Nesogordonia (Sterculiaceae) from Madagascar. Bulletin du muséum d'Histoire naturelle, Paris, 4e sér., vol. 9, section B, Adansonia no. 1: 95100.
. 1987b Tribal realignments of certain paleotropical Sterculiaceae. American Journal of Botany 74 (5, supplement): 724.
Baum, D. A., W. S. Alverson, and R. N. Nyffeler. 1998 A durian by any other name: taxonomy and nomenclature of the core Malvales. Harvard Papers in Botany 3: 317332.
, and K. Oginuma. 1994 A review of chromosome numbers in Bombacaceae with new counts from Adansonia. Taxon 43: 1120.
, R. L. Small, and J. F. Wendel. 1998 Biogeography and floral evolution of Baobabs (Adansonia, Bombacaceae) as inferred from multiple data sets. Systematic Biology 47: 181207.[CrossRef][ISI][Medline]
Bayer, C. 1999 The bicolor unit: homology and transformation of an inflorescence structure unique to core Malvales. Plant Systematics and Evolution. 214: 187198.[CrossRef][ISI]
, M. W. Chase, and M. F. Fay. 1998 Muntingiaceae, a new family of dicotyledons with malvalean affinities. Taxon 47: 3742.
, and K. Kubitzki. 1996 Inflorescence morphology of some Australian Lasiopetaleae (Sterculiaceae). Telopea 6: 721728.
, M. F. Fay, A. Y. De Bruijn, V. Savolainen, C. M. Morton, K. Kubitzki, W. S. Alverson, and M. W. Chase. 1999 Support for an expanded family concept of Malvaceae within a recircumscribed order Malvales: a combined analysis of plastid atpB and rbcL DNA sequences. Botanical Journal of the Linaean Society 129: 267303.
Benn, S. J., and D. E. Lemke. 1991 Taxonomy of Neotessmannieae (Tiliaceae). American Journal of Botany 78 (6, supplement): 166167.
Bentham, G. and J. D. Hooker. 1867 Genera plantarum, vol. 1. L. Reeve and Co., London.
Bremer, K. 1988 The limits of amino-acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42: 795803.[CrossRef][ISI]
Burret, M. 1926 Beiträge zur Kenntnis der Tiliaceen. Notizblatt des Botanischen Gartens und Museums zu Berlin-Dahlem 9: 592880.
Chase, M. W., et al. 1993 Phylogenetics of seed plants: an analysis of nucleotide sequences from the plastic gene rbcL. Annals of the Missouri Botanical Garden 80: 528580.[CrossRef][ISI]
Clark, L. G., W. Zhang, and J. F. Wendel. 1995 A phylogeny of the grass family (Poaceae) based on ndhF data. Systematic Botany 20: 436460.
Cronquist, A. 1981 An integrated system of classification of flowering plants. Columbia University Press, New York, NY.
. 1988 The evolution and classification of flowering plants, 2nd. ed. New York Botanical Garden, Bronx, NY.
Dahlgren, G. 1989 The last Dahlgrenogram: system of classification of the dicotyledons. In K. Tan, R. R. Mill, and T. S. Elias [eds.], Plant taxonomy, phytogeography and related subjects, 249260. Edinburgh University, Edinburgh.
De Queiroz, K. 1997 The Linnaean hierarchy and the evolutionization of taxonomy, with emphasis on the problem of nomenclature. Aliso 15: 125144.
, and J. Gauthier. 1992 Phylogenetic taxonomy. Annual Review of Ecology and Systematics 23: 449480.[ISI]
, and . 1994 Toward a phylogenetic system of biological nomenclature. Trends in Ecology and Evolution 9: 2731.
Donoghue, M. J., R. G. Olmstead, J. F. Smith, and J. D. Palmer. 1992 Phylogenetic relationships of Dipsacales based on rbcL sequences. Annals of the Missouri Botanical Garden 79: 333345.
Edlin, H. L. 1935 A critical revision of certain taxonomic groups of the Malvales. New Phytologist 34: 120, 122143.[CrossRef]
Endress, P. K., and S. Stumpf. 1990 Non-tetrasporangiate stamens in the angiosperms:structure, systematic distribution, and evolutionary aspects. Botanische Jahrbücher für Systematik, Pflanzengeschichte und Pflanzengeographie 112: 193240.
Fay, M. F., C. Bayer, W. S. Alverson, A. Y. De Bruijn, and M. Chase. 1998 Plastid rbcL sequence data indicate a close affinity between Diegodendron and Bixa. Taxon 47: 4350.
Freytag, G. F. 1951 A revision of the genus Guazuma. Ceiba 1: 193225.
Fryxell, P. A. 1968 A redefinition of the tribe Gossypieae. Botanical Gazette (Chicago) 129: 296308.
Gaut, B., S. V. Muse, W. D. Clark, and M. Clegg. 1992 Relative rates of nucleotide substitution at the rbcL locus of monocotyledonous plants. Journal of Molecular Evolution 35: 292303.[CrossRef][ISI][Medline]
Hillis, D. M., and J. P. Huelsenbeck. 1992 Signal, noise, and reliability in molecular phylogenetic analyses. Journal of Heredity 83: 189195.
Hutchinson, J. 1967 The genera of flowering plants, Dicotyledones, vol. 2. Clarendon Press, Oxford.
Jenny, M. 1988 Different gynoecium types in Sterculiaceae: ontogeny and functional aspects. In P. Leins, S. C. Tucker, and P. K. Endress [eds.], Aspects of floral development, 225236. Stuttgart, Berlin.
Judd, W. S., and S. R. Manchester. 1997 Circumscription of Malvaceae (Malvales) as determined by a preliminary cladistic analysis of morphological, anatomical, palynological, and chemical characters. Brittonia 49: 384405.[CrossRef][ISI]
, R. W. Sanders, and M. J. Donoghue. 1994 Angiosperm family pairs: preliminary phylogenetic analyses. Harvard Papers in Botany 5: 151.
Källersjö, M., J. S. Farris, A. G. Kluge, and C. Bult. 1992 Skewness and permutation. Cladistics 8: 275287.
Kelman, W. M. 1991 A revision of Fremontodendron (Sterculiaceae). Systematic Botany 16: 320.
Kim, K.-J., and R. K. Jansen. 1995 ndhF sequence evolution and the major clades in the sunflower family. Proceedings of the National Academy of Sciences. USA: 92: 1037910383.
Kostermans, A. J. G. H. 1960 Miscellaneous botanical notes 1. Reinwardtia 5: 233254.
Kubitzki, K. 1995 Asterophorum and Tahitia congeneric with Christiana (Tiliaceae). Botanische Jahrbücher für Systematik, Pflanzengeschichte und Pflanzengeographie 116: 537542.
La Duke, J. C., and J. Doebley. 1995 A chloroplast DNA based phylogeny of the Malvaceae. Systematic Botany 20: 259271.
Manchester, S. F. 1992 Flowers, fruits, and pollen of Florissantia, an extinct Malvalean genus from the Eocene and Oligocene of Western North America. American Journal of Botany 79: 9961008.[CrossRef][ISI]
Masters, M. T. 1875 Monographic sketch of the Durioneae. Journal of the Linnaean Society, Botany 14: 495506, plates 1416.
Olmstead, R. G., and J. A. Sweere. 1994 Combining data in phylogenetic systematics: an empirical approach using three molecular data sets in the Solanaceae. Systematic Biology 43: 467481.[CrossRef][ISI]
, J. A. Sweere, and K. H. Wolfe. 1993 Ninety extra nucleotides in the ndhF gene of tobacco chloroplast DNA: a summary of revisions to the 1986 genome sequence. Plant Molecular Biology 22: 11911193.[CrossRef][ISI][Medline]
Ren, Z. 1989 The cladistic analysis of the systematic position of Craigia. Acta Botanica Yunnanica 11: 1723.
Ridley, H. N. 1922 The flora of the Malay Peninsula, vol. 1, Polypetaleae. L. Reeve and Co., Ashford, Kent.
Robyns, A., and J. Cuatrecasas. 1964 Flora of Panama, part VI, family 117, Sterculiaceae. Annals of the Missouri Botanical Garden 51: 69107.[CrossRef]
, S. Nilsson, and R. Dechamps. 1977 Sur la position systématique du genre Maxwellia Baillon. Bulletin du Jardin botanique national de Belgique 47: 145153.[CrossRef]
Seelanan, T., A. Schnabel, and J. F. Wendel. 1997 Congruence and consensus in the cotton tribe. Systematic Botany 22: 259290.[CrossRef][ISI]
Smith, J. F., K. J. Sytsma, J. S. Shoemaker, and R. L. Smith. 1990 A qualitative comparison of cellular DNA extraction protocols. Phytochemical Bulletin 22 (3/4): 2734.
, J. C. Wolfram, K. D. Brown, C. L. Karol, and D. S. Denton. 1997 Tribal relationships in the Gesneriaceae: evidence from DNA sequences of the chloroplast gene ndhF. Annals of the Missouri Botanical Garden 84: 5066.